Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

G2138781

Basic Information

Item	Value
gene id	G2138781
gene name	NA
gene type	non-coding
species	rainbow trout (Oncorhynchus mykiss)
category of species	economic fish

Chromosome Information

Item	Value
chromosome id	NC_048592.1
NCBI id	CM023246.2
chromosome length	43716683
location	43407242 ~ 43407474 (-)
genome version	USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2446227
GGGTTATAGGGTTGTAGCTGGATAATAGGACTGGATCTGGGTTATAGGGCTGTAGCTGGATAATAGGACTGGATCTGGGTTATAGGGCTAGAGCTGGATAATATGACTGGATCTGGGTTATAGGGCTGTAGCTGGATAATAGGACTGGATCTGGGTTATAGGGCTCGAGATGGATAATAGGACTGGATCTGGGTTATAGGGCTAGAGCTGGATAATAGGACTGGATCCGGGAT

Function

GO: NA

KEGG: NA

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TU2446227	True	233	lncRNA	0.47	1	43407242	43407474

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
emilin2a	LOC106595984	coding	downstream	9208	43343531 ~ 43398034 (-)
LOC118944838	LOC106596014	coding	downstream	329782	43041222 ~ 43077460 (-)
LOC110509179	LOC105010334	coding	downstream	419883	42973355 ~ 42987359 (-)
LOC110508296	pde1c	coding	downstream	447834	42877496 ~ 42959408 (-)
LOC110509177	LOC106597278	coding	downstream	634405	42733643 ~ 42772837 (-)
G2138776	NA	non-coding	downstream	8275	43398756 ~ 43398967 (-)
G2138741	NA	non-coding	downstream	74969	43313416 ~ 43332273 (-)
G2138694	NA	non-coding	downstream	102353	43304471 ~ 43304889 (-)
G2138691	NA	non-coding	downstream	123244	43280414 ~ 43283998 (-)
G2138679	NA	non-coding	downstream	159370	43246749 ~ 43247872 (-)
G2138859	NA	non-coding	upstream	37058	43444532 ~ 43448124 (-)
G2138871	NA	non-coding	upstream	59306	43466780 ~ 43469437 (-)
G2138883	NA	non-coding	upstream	80501	43487975 ~ 43488244 (-)
G2138886	NA	non-coding	upstream	87394	43494868 ~ 43495115 (-)
G2138887	NA	non-coding	upstream	88241	43495715 ~ 43503577 (-)
G2138294	LOC106594920	other	downstream	1055790	42349216 ~ 42351452 (-)
G2137814	LOC106597294	other	downstream	1180277	42220922 ~ 42226965 (-)
G2137648	LOC106596196	other	downstream	1593041	41810795 ~ 41814201 (-)
G2137555	NA	other	downstream	1670853	41731714 ~ 41736389 (-)

Expression

Co-expression Network