trnat-ugu-46



Basic Information


Item Value
gene id trnat-ugu-46
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 5769643 ~ 5769714 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnat-ugu-46
ggcatggtggccaagcggtaaggcgtcggtcttgtaaaccaaagatcatgggttcaaatcccatctttgcct

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnat-ugu-46 True 72 mRNA 0.51 1 5769643 5769714
Loading

Neighbor


gene id symbol gene type direction distance location
trnaa-ugc-222 NA coding downstream 14135 5755437 ~ 5755508 (-)
trnat-cgu-91 NA coding downstream 14652 5754920 ~ 5754991 (-)
trnaa-ugc-221 NA coding downstream 16401 5753171 ~ 5753242 (-)
trnat-cgu-90 NA coding downstream 16913 5752659 ~ 5752730 (-)
trnaa-ugc-220 NA coding downstream 18666 5750906 ~ 5750977 (-)
trnaa-cgc-7 NA coding upstream 13243 5782957 ~ 5783028 (-)
trnaa-cgc-8 NA coding upstream 23980 5793694 ~ 5793765 (-)
LOC110511721 NA coding upstream 57330 5827044 ~ 5827912 (-)
LOC118945579 NA coding upstream 126692 5896406 ~ 5929252 (-)
LOC118945553 NA coding upstream 127189 5896903 ~ 5897084 (-)
G2145344 NA non-coding downstream 15775 5751300 ~ 5753868 (-)
G2145342 NA non-coding downstream 17915 5744297 ~ 5751728 (-)
G2145336 NA non-coding downstream 21103 5708741 ~ 5748540 (-)
G2145326 NA non-coding downstream 66212 5694920 ~ 5703431 (-)
G2145314 NA non-coding downstream 99763 5638808 ~ 5669880 (-)
G2145345 NA non-coding upstream 1216 5770930 ~ 5777155 (-)
G2145347 NA non-coding upstream 1675 5771389 ~ 5777703 (-)
G2145356 NA non-coding upstream 24735 5794449 ~ 5797345 (-)
G2145510 NA non-coding upstream 36540 5806254 ~ 5806647 (-)
G2145512 NA non-coding upstream 39164 5808878 ~ 5809112 (-)
G2145335 NA other downstream 13977 5749686 ~ 5755666 (-)
G2145316 opi-1 other downstream 96953 5641476 ~ 5672690 (-)
G2144911 NA other downstream 543332 5215083 ~ 5226311 (-)
LOC110509531 LOC106570883 other downstream 1339107 4208866 ~ 4430679 (-)
G2143134 NA other downstream 2134403 3628165 ~ 3635240 (-)
G2145511 NA other upstream 37351 5807065 ~ 5807624 (-)
G2145604 NA other upstream 331057 6100771 ~ 6108752 (-)
G2145618 LOC106591448 other upstream 371352 6141066 ~ 6148494 (-)
G2145542 NA other upstream 379862 6137289 ~ 6252866 (-)
LOC110509559 NA other upstream 811477 6579264 ~ 6594474 (-)

Expression


trnat-ugu-46 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network