LOC118945711



Basic Information


Item Value
gene id LOC118945711
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 14040434 ~ 14040567 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005040826.1
TGGAGGACTGAGAAGGTTTAGCAGCTTGTTCTGTGCTGTTATAACTGGTTATAACCTCCTAAATGGAAAATAAGGCGAATGCAACAACCGGCTCTGAGACACTTAAGAACTGATGTTGTGTTTGTGAACATAAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005040826.1 True 134 mRNA 0.40 1 14040434 14040567
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118945712 NA coding upstream 963 14039336 ~ 14039471 (+)
slc31a1 LOC106563027 coding upstream 12112 14015042 ~ 14028322 (+)
atp6v1g1 LOC106563029 coding upstream 30266 14000254 ~ 14010168 (+)
LOC110509680 LOC106563031 coding upstream 43981 13958633 ~ 13996453 (+)
LOC110509328 LOC106563105 coding upstream 98006 13940187 ~ 13942428 (+)
LOC110509688 LOC106563021 coding downstream 131232 14171799 ~ 14175996 (+)
LOC110509690 LOC106563020 coding downstream 174555 14215122 ~ 14231240 (+)
LOC110509691 LOC106563019 coding downstream 248645 14289212 ~ 14396808 (+)
LOC110509696 LOC106563151 coding downstream 745420 14785987 ~ 14806264 (+)
LOC110509698 NA coding downstream 835150 14875717 ~ 14879923 (+)
G2154565 NA non-coding upstream 27011 14013216 ~ 14013423 (+)
G2154564 NA non-coding upstream 27353 14012881 ~ 14013081 (+)
G2154533 NA non-coding upstream 58783 13946469 ~ 13981651 (+)
G2154512 NA non-coding upstream 104615 13915670 ~ 13935819 (+)
G2154396 NA non-coding upstream 253719 13786515 ~ 13786715 (+)
G2154573 NA non-coding downstream 3603 14044170 ~ 14044421 (+)
G2154574 NA non-coding downstream 3886 14044453 ~ 14044814 (+)
G2154575 NA non-coding downstream 4398 14044965 ~ 14045498 (+)
G2154750 LOC106563023 non-coding downstream 29686 14070253 ~ 14071153 (+)
G2154823 NA non-coding downstream 160316 14200883 ~ 14201383 (+)
G2154438 NA other upstream 226464 13806013 ~ 13813970 (+)
G2154391 NA other upstream 264300 13772708 ~ 13776134 (+)
G2154294 NA other upstream 371264 13668289 ~ 13669170 (+)
G2153316 NA other upstream 1279944 12759880 ~ 12760490 (+)
G2155696 NA other downstream 978060 15018627 ~ 15093949 (+)
G2157602 NA other downstream 2310150 16350717 ~ 16353665 (+)
G2158499 LOC106563144 other downstream 3148777 17189344 ~ 17191128 (+)
LOC110509751 LOC106563328 other downstream 5019976 18962089 ~ 19065920 (+)
LOC118945267 NA other downstream 5025611 19066137 ~ 19068784 (+)

Expression


LOC118945711 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

LOC118945711 Expression in each Bioproject

Bar chart with 13 bars.
LOC118945711 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network