G2140235



Basic Information


Item Value
gene id G2140235
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 1114015 ~ 1115585 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2447914
gtgaacaggcagtggctcgggtggttgatgtccttgatgatctttatggccttcctgtgacatcgggtggtgtaggtgtcctggagggcaggtagtttgcccccggtgatgcgttgtgcagacctcaccaccctctggagagccttacggttgagggcggagcagttgccgtaccaggtggtgatacagcccgccaggatgctctcgattgtgcatctgtagaagtttgtgagtgcttttggtgacaagccgaatttcttcagcctcctgaggttgaagaggcgctgctgcgccttcttcacaatgctgtctgtgtgtgttaaccaattcagtttgtctgtgatgtgtatgccgaggaacttaaaacttgctaccctctccactactgttccatcgatgtggataggggggtgttccctctgctgtttcctgaagtccacaatcatctccttagttttgttgacgttgagtgtgaggttattttcctgacaccacactccgagggccctcacctcctccctgtaggccgtctcgtcgttgttggtaatcaagcctaccactgtcgtgtcgtccgcaaacttgatgattgagttggaggcgtgcgtggccacgcagtcgtgggtgaacagggagtacaggagagggctcagaacgcacccttgtggggccccagtgttgaggatcagcggggaggagatgttgttgcctaccctcaccacctgggggcggcccgtcaggaagtccagtacccagttgcacagggcggggtcgagactcagggtctcgagcttgatgacgagcttggagggtactatggtgttgaatgccgagctgtagtcaatgaacagcattctcacataggtattcctcttgtccagatgggttagggcggtgtgcagtgtggttgagattgcatcgtctgtggacctatttgggcggtaagcaaattggagtgggtctagggtgtcaggtagggtggaggtgatatggtccttgactagtctctcaaagcacttcatgatgacggaagtgagtgctacggggcggtagtcatttagctcagttaccttagctttcttgggaacaggaacaatggtggccctcttgaagcatgtgggaacagcagactggtatagggattgattgaatatgtccgtaaacacaccggccagctggtctgcgcatgctctgagggcgcggctggggatgccgtctgggcctgcagccttgcgagggttaacacgtttaaatgtcttactcacctcggctgcagtgaaggagagaccgcatgttttcgttgcaggccgtgtcagtggcactgtattgtcctcaaagcgggcaaaaaagttatttagtctgcctgggagcaggacatcctggtccgtgactgggctggatttcttcctgtagtccgtgattgactgtagaccctgccacatgcctcttgtgtctgagccgttgaattgagattctactttgtctctgtactgacgattagcttgtttgatagccttgcggagggaatagctgcactgtttgtattcggtcatgttaccagacaccttgccctg

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2447914 True 1571 lncRNA 0.53 1 1114015 1115585

Neighbor


gene id symbol gene type direction distance location
LOC110509503 LOC106562869 coding upstream 270002 835828 ~ 844013 (+)
LOC110509499 LOC106562841 coding upstream 410189 694527 ~ 703826 (+)
LOC110509498 LOC106562841 coding upstream 419667 691741 ~ 694348 (+)
LOC110509496 LOC106562840 coding upstream 463889 632021 ~ 650126 (+)
LOC100305272 dpm2 coding upstream 485018 619789 ~ 629216 (+)
LOC110509506 LOC106562870 coding downstream 155911 1271496 ~ 1429741 (+)
LOC110509509 LOC106562874 coding downstream 403831 1519416 ~ 1532574 (+)
LOC110509512 LOC106562877 coding downstream 439040 1554625 ~ 1558840 (+)
LOC110509295 LOC106562719 coding downstream 456917 1572502 ~ 1618684 (+)
LOC110509513 LOC106562718 coding downstream 539007 1654592 ~ 1662205 (+)
G2140234 NA non-coding upstream 359 1113361 ~ 1113656 (+)
G2140229 NA non-coding upstream 2576 1110678 ~ 1111439 (+)
G2140226 NA non-coding upstream 8995 1104341 ~ 1105020 (+)
G2140215 NA non-coding upstream 29607 1084173 ~ 1084408 (+)
G2140214 NA non-coding upstream 30621 1083024 ~ 1083394 (+)
G2140237 NA non-coding downstream 535 1116120 ~ 1116439 (+)
G2140263 NA non-coding downstream 28977 1144562 ~ 1211869 (+)
G2140369 NA non-coding downstream 105844 1221429 ~ 1221828 (+)
G2140511 NA non-coding downstream 342614 1458199 ~ 1458409 (+)
G2140520 NA non-coding downstream 363333 1478918 ~ 1479139 (+)
G2139520 LOC106562868 other upstream 260228 852249 ~ 853787 (+)
LOC110509291 LOC106562839 other upstream 523211 536258 ~ 614583 (+)
G2139202 NA other upstream 788967 324366 ~ 325048 (+)
G2139145 NA other upstream 955182 158015 ~ 158833 (+)
LOC110509486 LOC106562830 other upstream 964762 131779 ~ 149258 (+)
LOC110509554 LOC105007341 other downstream 822799 1935597 ~ 1941376 (+)
G2142277 NA other downstream 1967632 3083217 ~ 3083571 (+)
G2142386 LOC106562824 other downstream 2203364 3318949 ~ 3324094 (+)

Expression


G2140235 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G2140235 Expression in each Bioproject

Bar chart with 20 bars.
G2140235 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network