G2141258



Basic Information


Item Value
gene id G2141258
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 1598021 ~ 1613209 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2449041
tttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctgaacccaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatccaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgggacggagatttgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggtt

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2449041 True 405 TUCP 0.45 2 1598021 1613209
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110509510 LOC100194725 coding downstream 43380 1551060 ~ 1554641 (-)
LOC118945677 NA coding downstream 44059 1553886 ~ 1553962 (-)
LOC118945682 NA coding downstream 44405 1553548 ~ 1553616 (-)
LOC118945683 NA coding downstream 44815 1553138 ~ 1553206 (-)
LOC118945678 NA coding downstream 45200 1552754 ~ 1552821 (-)
LOC110509306 LOC106562912 coding upstream 322066 1935275 ~ 1935940 (-)
LOC110509556 LOC106562911 coding upstream 327977 1941186 ~ 1943193 (-)
LOC118945681 NA coding upstream 330777 1943986 ~ 1944040 (-)
mrps24 LOC106562909 coding upstream 429698 2042907 ~ 2044519 (-)
LOC110509353 LOC106562905 coding upstream 660304 2257334 ~ 2308157 (-)
G2141223 NA non-coding downstream 37131 1560458 ~ 1560890 (-)
G2141222 NA non-coding downstream 37645 1560143 ~ 1560376 (-)
G2141215 NA non-coding downstream 52943 1544864 ~ 1545078 (-)
G2141212 NA non-coding downstream 57648 1540124 ~ 1540373 (-)
G2141210 NA non-coding downstream 59455 1538360 ~ 1538566 (-)
G2141276 NA non-coding upstream 6988 1620197 ~ 1620523 (-)
G2141283 NA non-coding upstream 26868 1640077 ~ 1640443 (-)
G2141284 NA non-coding upstream 27614 1640823 ~ 1641093 (-)
G2141285 NA non-coding upstream 28336 1641545 ~ 1642228 (-)
G2141286 NA non-coding upstream 30407 1643616 ~ 1644236 (-)
LOC110509502 LOC106562868 other downstream 660112 843748 ~ 937986 (-)
LOC110509492 LOC106562836 other downstream 1169949 425727 ~ 437447 (-)
LOC110509490 LOC106562833 other downstream 1196466 398511 ~ 425356 (-)
G2139807 LOC106602244 other downstream 1219534 378211 ~ 378487 (-)
G2141289 LOC100380853 other upstream 36090 1649299 ~ 1649731 (-)
LOC110509525 LOC106562824 other upstream 1705734 3317596 ~ 3324117 (-)
G2143134 NA other upstream 2014956 3628165 ~ 3635240 (-)
LOC110509531 LOC106570883 other upstream 2708690 4208866 ~ 4430679 (-)
G2144911 NA other upstream 3601874 5215083 ~ 5226311 (-)

Expression


G2141258 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G2141258 Expression in each Bioproject

Bar chart with 16 bars.
G2141258 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network