G2140605



Basic Information


Item Value
gene id G2140605
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 1640206 ~ 1640438 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2448314
gttccagtcacaggcagcagagtactggaacgaaaggcgtgccaaatgaggtgttggctttagggatgatcagtgagatacacctgctggagcgcgtgctacggatgggtgttgccatcgtgaccagtgagctgagataaggcggagctttacctagcatggacttgtagatgacctggagccagtgggtctggcgatgaatatgtagcgagggccagccgactagagcatac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2448314 True 233 lncRNA 0.55 1 1640206 1640438

Neighbor


gene id symbol gene type direction distance location
LOC110509295 LOC106562719 coding upstream 21522 1572502 ~ 1618684 (+)
LOC110509512 LOC106562877 coding upstream 81366 1554625 ~ 1558840 (+)
LOC110509509 LOC106562874 coding upstream 107632 1519416 ~ 1532574 (+)
LOC110509506 LOC106562870 coding upstream 210465 1271496 ~ 1429741 (+)
LOC110509503 LOC106562869 coding upstream 796193 835828 ~ 844013 (+)
LOC110509513 LOC106562718 coding downstream 14154 1654592 ~ 1662205 (+)
LOC110509514 LOC106562918 coding downstream 80553 1720991 ~ 1760307 (+)
LOC110509515 LOC106563008 coding downstream 120825 1761263 ~ 1775741 (+)
LOC110509516 LOC106569151 coding downstream 142700 1783138 ~ 1821590 (+)
LOC110509558 cnnm3 coding downstream 186073 1826511 ~ 1852848 (+)
G2140581 NA non-coding upstream 938 1637304 ~ 1639268 (+)
G2140580 NA non-coding upstream 4381 1621003 ~ 1635825 (+)
G2140593 NA non-coding upstream 26332 1612314 ~ 1613874 (+)
G2140577 NA non-coding upstream 69445 1570463 ~ 1570761 (+)
G2140575 NA non-coding upstream 71299 1568700 ~ 1568907 (+)
G2140609 NA non-coding downstream 12169 1652607 ~ 1652843 (+)
G2140667 NA non-coding downstream 182408 1822846 ~ 1826321 (+)
G2140692 NA non-coding downstream 223604 1864042 ~ 1864303 (+)
G2140693 NA non-coding downstream 223952 1864390 ~ 1864645 (+)
G2140698 NA non-coding downstream 226950 1867388 ~ 1867612 (+)
G2139520 LOC106562868 other upstream 786419 852249 ~ 853787 (+)
LOC110509291 LOC106562839 other upstream 1049402 536258 ~ 614583 (+)
G2139202 NA other upstream 1315158 324366 ~ 325048 (+)
LOC110509554 LOC105007341 other downstream 297946 1935597 ~ 1941376 (+)
G2142277 NA other downstream 1442779 3083217 ~ 3083571 (+)
G2142386 LOC106562824 other downstream 1678511 3318949 ~ 3324094 (+)
G2144385 NA other downstream 3387313 5027751 ~ 5028239 (+)
G2144416 NA other downstream 3394751 5035189 ~ 5035913 (+)

Expression


G2140605 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G2140605 Expression in each Bioproject

Bar chart with 15 bars.
G2140605 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network