G2141320



Basic Information


Item Value
gene id G2141320
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 1703117 ~ 1703637 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2449110
AAATGTACGGATTCAAGAACTGGCGCTCTATGGATACGACTCCAACGAGACCGGCCCTGCAGAATCGGGAACGCTTGATGAAAAAAGTCTAGTGCCCTCGGTATCCACGATTCGTCAGAACAGCCAGCGCCAAAAAAGCCGAGACTCCTCCCCGGCGAAAAACGGCACAGAAGGACACATACATCTAGAGCTGGGGGATTCCGGCTCACCAAACATTTCCAATGAAACACCCAAAGCGGAGGATATCCCTGTTTTTAATGACATTTCAGAGGTTGACGACCGGTTATTCTGTGATGCGGCCAACCTTCTTGAC

Function


NR:

description
PREDICTED: uncharacterized protein LOC106586305 isoform X3

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2449110 True 313 lncRNA 0.50 3 1703117 1703637

Neighbor


gene id symbol gene type direction distance location
LOC110509510 LOC100194725 coding downstream 148476 1551060 ~ 1554641 (-)
LOC118945677 NA coding downstream 149155 1553886 ~ 1553962 (-)
LOC118945682 NA coding downstream 149501 1553548 ~ 1553616 (-)
LOC118945683 NA coding downstream 149911 1553138 ~ 1553206 (-)
LOC118945678 NA coding downstream 150296 1552754 ~ 1552821 (-)
LOC110509306 LOC106562912 coding upstream 231638 1935275 ~ 1935940 (-)
LOC110509556 LOC106562911 coding upstream 237549 1941186 ~ 1943193 (-)
LOC118945681 NA coding upstream 240349 1943986 ~ 1944040 (-)
mrps24 LOC106562909 coding upstream 339270 2042907 ~ 2044519 (-)
LOC110509353 LOC106562905 coding upstream 569876 2257334 ~ 2308157 (-)
G2141291 NA non-coding downstream 50669 1652136 ~ 1652448 (-)
G2141286 NA non-coding downstream 58881 1643616 ~ 1644236 (-)
G2141285 NA non-coding downstream 60889 1641545 ~ 1642228 (-)
G2141284 NA non-coding downstream 62024 1640823 ~ 1641093 (-)
G2141283 NA non-coding downstream 62674 1640077 ~ 1640443 (-)
G2141411 NA non-coding upstream 148450 1852087 ~ 1855651 (-)
G2141413 NA non-coding upstream 152339 1855976 ~ 1856194 (-)
G2141438 NA non-coding upstream 208971 1912608 ~ 1912838 (-)
G2141439 NA non-coding upstream 209513 1913150 ~ 1913422 (-)
G2141497 NA non-coding upstream 294920 1998557 ~ 2029446 (-)
G2141289 LOC100380853 other downstream 53386 1649299 ~ 1649731 (-)
G2141258 NA other downstream 89908 1598021 ~ 1613209 (-)
LOC110509502 LOC106562868 other downstream 765208 843748 ~ 937986 (-)
LOC110509492 LOC106562836 other downstream 1275045 425727 ~ 437447 (-)
LOC110509490 LOC106562833 other downstream 1301562 398511 ~ 425356 (-)
LOC110509525 LOC106562824 other upstream 1615306 3317596 ~ 3324117 (-)
G2143134 NA other upstream 1924528 3628165 ~ 3635240 (-)
LOC110509531 LOC106570883 other upstream 2618262 4208866 ~ 4430679 (-)
G2144911 NA other upstream 3511446 5215083 ~ 5226311 (-)
G2145316 opi-1 other upstream 3937839 5641476 ~ 5672690 (-)

Expression


G2141320 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G2141320 Expression in each Bioproject

Bar chart with 13 bars.
G2141320 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network