G2143134



Basic Information


Item Value
gene id G2143134
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 3628165 ~ 3635240 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2451088
tataaatgcaccagcactgtgatagtctcagaggtccgttaaaagcacagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaataagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccatag

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU2451088 True 354 TUCP 0.46 2 3628165 3635240
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110509526 LOC106562882 coding downstream 152738 3449799 ~ 3475427 (-)
LOC110509525 LOC106562824 coding downstream 304048 3317596 ~ 3324117 (-)
LOC110509519 LOC106562828 coding downstream 547945 3065595 ~ 3080220 (-)
LOC110509517 LOC106562762 coding downstream 805603 2643985 ~ 2822562 (-)
LOC118945570 NA coding downstream 1116294 2511685 ~ 2511871 (-)
LOC110509529 NA coding upstream 409041 4044281 ~ 4062480 (-)
LOC110509299 ptpa coding upstream 513220 4148460 ~ 4158891 (-)
LOC110509531 LOC106570883 coding upstream 573626 4208866 ~ 4430679 (-)
LOC118945302 NA coding upstream 590183 4225423 ~ 4229194 (-)
LOC110509302 psmb7 coding upstream 985159 4620399 ~ 4636327 (-)
G2143122 NA non-coding downstream 10447 3617427 ~ 3617718 (-)
G2143120 NA non-coding downstream 12375 3615570 ~ 3615790 (-)
G2143118 NA non-coding downstream 16071 3611831 ~ 3612094 (-)
G2143115 NA non-coding downstream 20443 3607506 ~ 3607722 (-)
G2143112 NA non-coding downstream 26224 3601669 ~ 3601941 (-)
G2143140 NA non-coding upstream 5 3635245 ~ 3635458 (-)
G2143158 NA non-coding upstream 33939 3669179 ~ 3669809 (-)
G2143164 NA non-coding upstream 41064 3676304 ~ 3676955 (-)
G2143208 NA non-coding upstream 95182 3730422 ~ 3730972 (-)
G2143322 NA non-coding upstream 259490 3894730 ~ 3894954 (-)
G2141289 LOC100380853 other downstream 1978434 1649299 ~ 1649731 (-)
G2141258 NA other downstream 2014956 1598021 ~ 1613209 (-)
LOC110509502 LOC106562868 other downstream 2690256 843748 ~ 937986 (-)
LOC110509492 LOC106562836 other downstream 3200093 425727 ~ 437447 (-)
G2144911 NA other upstream 1579843 5215083 ~ 5226311 (-)
G2145316 opi-1 other upstream 2006236 5641476 ~ 5672690 (-)
G2145335 NA other upstream 2114446 5749686 ~ 5755666 (-)
G2145511 NA other upstream 2171825 5807065 ~ 5807624 (-)

Expression


G2143134 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G2143134 Expression in each Bioproject

Bar chart with 17 bars.
G2143134 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network