G2144151



Basic Information


Item Value
gene id G2144151
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 4644974 ~ 4645334 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2452161
catgtacactattatagtctctaaaatgacctggatgccatgtacactattatagtctctaaaatgacctggatgccatgtacactattatagtctctaaaatgacatggatgccatgtacagtattatagtctctaaaatgacctggatgccatgtacactattatagtctctaaaatgacatggatgccatgtacagtattatagtctctaaaatgacctggatgccatgtacactattatagtctctaaaatgacctggatgccatgtacactattatagtctctaaaatgacatggatgccatgtacagtattatagtctctaaaatgacatggatgccatgtacactattatagtc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2452161 True 361 lncRNA 0.35 1 4644974 4645334
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110509302 psmb7 coding downstream 21538 4620399 ~ 4636327 (-)
LOC110509531 LOC106570883 coding downstream 214295 4208866 ~ 4430679 (-)
LOC118945302 NA coding downstream 415780 4225423 ~ 4229194 (-)
LOC110509299 ptpa coding downstream 486083 4148460 ~ 4158891 (-)
LOC110509529 NA coding downstream 582494 4044281 ~ 4062480 (-)
LOC110509533 LOC106562887 coding upstream 40190 4685524 ~ 4690341 (-)
LOC110509534 LOC105021738 coding upstream 176859 4822193 ~ 4852134 (-)
LOC110509535 purg coding upstream 221376 4866710 ~ 4871169 (-)
LOC110509538 LOC106562893 coding upstream 423265 5068599 ~ 5124878 (-)
LOC110509542 fbxw2 coding upstream 869557 5514891 ~ 5523585 (-)
G2144098 NA non-coding downstream 55289 4589374 ~ 4589685 (-)
G2144086 LOC106583873 non-coding downstream 67746 4576508 ~ 4577228 (-)
G2144072 NA non-coding downstream 78349 4566406 ~ 4566625 (-)
G2144064 NA non-coding downstream 83712 4560673 ~ 4561262 (-)
G2144156 NA non-coding upstream 19429 4664763 ~ 4664999 (-)
G2144176 NA non-coding upstream 33398 4678732 ~ 4680595 (-)
G2144189 NA non-coding upstream 53288 4698622 ~ 4698927 (-)
G2144211 NA non-coding upstream 78150 4723484 ~ 4723886 (-)
G2144212 NA non-coding upstream 78814 4724148 ~ 4724474 (-)
G2143134 NA other downstream 1009734 3628165 ~ 3635240 (-)
LOC110509525 LOC106562824 other downstream 1320878 3317596 ~ 3324117 (-)
G2141289 LOC100380853 other downstream 2995243 1649299 ~ 1649731 (-)
G2141258 NA other downstream 3031765 1598021 ~ 1613209 (-)
G2144911 NA other upstream 569749 5215083 ~ 5226311 (-)
G2145316 opi-1 other upstream 996142 5641476 ~ 5672690 (-)
G2145335 NA other upstream 1104352 5749686 ~ 5755666 (-)
G2145511 NA other upstream 1161731 5807065 ~ 5807624 (-)
G2145604 NA other upstream 1455437 6100771 ~ 6108752 (-)

Expression


G2144151 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G2144151 Expression in each Bioproject

Bar chart with 3 bars.
G2144151 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network