G2144192



Basic Information


Item Value
gene id G2144192
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 4701507 ~ 4701790 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2452202
actataatactgaatgaacacttattttaacttaatataatacatcaataaaatcaatttagcctcaaataaataatgacacatgttcaatttggtttaaataatgcaaaaacaaagtgttggagaagaaagtaaaagtgcaatatgtgccatgtaagaaagctaatgtttaagttccttgctcagaacatgagaacatatgaaagctggtggttccttttaacatgagtcttcaatattcccaggtaagaagttttaggtgatagttattataggactatttc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2452202 True 284 lncRNA 0.29 1 4701507 4701790

Neighbor


gene id symbol gene type direction distance location
LOC110509532 LOC106562866 coding upstream 215874 4474634 ~ 4485633 (+)
LOC110509300 NA coding upstream 494522 4170102 ~ 4207105 (+)
LOC110509530 LOC106562884 coding upstream 576781 4122406 ~ 4124726 (+)
LOC110509527 NA coding upstream 969978 3705668 ~ 3731529 (+)
LOC118945361 NA coding upstream 1146357 3545047 ~ 3555150 (+)
LOC110509354 pde4d coding downstream 44560 4746350 ~ 4777161 (+)
LOC110509536 LOC106562892 coding downstream 250826 4952616 ~ 5021603 (+)
LOC110509539 LOC106562896 coding downstream 468072 5169862 ~ 5257753 (+)
LOC118945351 NA coding downstream 556303 5258093 ~ 5260025 (+)
LOC110509541 LOC106562900 coding downstream 639585 5341375 ~ 5479000 (+)
G2144174 LOC106562887 non-coding upstream 12805 4687089 ~ 4688702 (+)
G2144157 NA non-coding upstream 28810 4665550 ~ 4672697 (+)
G2144155 NA non-coding upstream 37447 4663670 ~ 4664060 (+)
G2144154 NA non-coding upstream 43411 4657825 ~ 4658096 (+)
G2144153 NA non-coding upstream 45420 4655758 ~ 4656087 (+)
G2144193 NA non-coding downstream 390 4702180 ~ 4702392 (+)
G2144197 NA non-coding downstream 4093 4705883 ~ 4707191 (+)
G2144206 NA non-coding downstream 12254 4714044 ~ 4714253 (+)
G2144209 NA non-coding downstream 15991 4717781 ~ 4717998 (+)
G2144236 NA non-coding downstream 41539 4743329 ~ 4775444 (+)
G2142386 LOC106562824 other upstream 1377413 3318949 ~ 3324094 (+)
G2142277 NA other upstream 1617936 3083217 ~ 3083571 (+)
LOC110509554 LOC105007341 other upstream 2760516 1935597 ~ 1941376 (+)
LOC110509295 LOC106562719 other upstream 3122948 1572502 ~ 1618684 (+)
LOC110509506 LOC106562870 other upstream 3271773 1271496 ~ 1429741 (+)
G2144385 NA other downstream 325961 5027751 ~ 5028239 (+)
G2144416 NA other downstream 333399 5035189 ~ 5035913 (+)
G2144756 NA other downstream 582071 5283861 ~ 5284603 (+)
G2144802 NA other downstream 658196 5359986 ~ 5375497 (+)
LOC110509544 LOC106562892 other downstream 904259 5605462 ~ 5611062 (+)

Expression


G2144192 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G2144192 Expression in each Bioproject

Bar chart with 19 bars.
G2144192 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network