G2144544



Basic Information


Item Value
gene id G2144544
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 5005991 ~ 5006226 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2452569
GCCAACTGGGAGGAGGAGTAGTGGGCCACGATGATTAGAGGAACAGATAGCGACAGCAGCATTCCTTTGATTAGCTCCTCAAATTCACTCGCTGTCATCTCAGGGAGACGCAAAATACAACTCCCTCCGTTCCTTTGCTTCCTCCACACTCCGATTACATCTCAATAGGCATCTTTTTTTTGCTCCACCTCGTAGATGAAAGCCAGGCCTTAAAGGTCTTATTGCTGCTGTTTTGC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2452569 True 236 lncRNA 0.48 1 5005991 5006226
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110509535 purg coding downstream 134822 4866710 ~ 4871169 (-)
LOC110509534 LOC105021738 coding downstream 153857 4822193 ~ 4852134 (-)
LOC110509533 LOC106562887 coding downstream 315650 4685524 ~ 4690341 (-)
LOC110509302 psmb7 coding downstream 382555 4620399 ~ 4636327 (-)
LOC118945302 NA coding downstream 776797 4225423 ~ 4229194 (-)
LOC110509538 LOC106562893 coding upstream 62373 5068599 ~ 5124878 (-)
LOC110509542 fbxw2 coding upstream 508665 5514891 ~ 5523585 (-)
LOC118945317 NA coding upstream 635226 5641452 ~ 5641777 (-)
LOC118945316 NA coding upstream 635625 5641851 ~ 5643016 (-)
opi-1 opi-1 coding upstream 650360 5656586 ~ 5658119 (-)
G2144510 LOC106562892 non-coding downstream 51982 4953441 ~ 4954009 (-)
G2144448 NA non-coding downstream 152976 4852691 ~ 4853015 (-)
G2144440 NA non-coding downstream 162095 4843371 ~ 4843896 (-)
G2144300 NA non-coding downstream 185315 4820461 ~ 4820676 (-)
G2144295 NA non-coding downstream 210716 4794692 ~ 4795275 (-)
G2144548 NA non-coding upstream 4511 5010737 ~ 5010988 (-)
G2144550 NA non-coding upstream 5819 5012045 ~ 5012492 (-)
G2144552 NA non-coding upstream 8419 5014645 ~ 5015479 (-)
G2144555 NA non-coding upstream 13054 5019280 ~ 5019543 (-)
G2144556 LOC106562892 non-coding upstream 14028 5020254 ~ 5021562 (-)
LOC110509531 LOC106570883 other downstream 575455 4208866 ~ 4430679 (-)
G2143134 NA other downstream 1370751 3628165 ~ 3635240 (-)
LOC110509525 LOC106562824 other downstream 1681895 3317596 ~ 3324117 (-)
G2141289 LOC100380853 other downstream 3356260 1649299 ~ 1649731 (-)
G2141258 NA other downstream 3392782 1598021 ~ 1613209 (-)
G2144911 NA other upstream 208857 5215083 ~ 5226311 (-)
G2145316 opi-1 other upstream 635250 5641476 ~ 5672690 (-)
G2145335 NA other upstream 743460 5749686 ~ 5755666 (-)
G2145511 NA other upstream 800839 5807065 ~ 5807624 (-)
G2145604 NA other upstream 1094545 6100771 ~ 6108752 (-)

Expression


G2144544 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G2144544 Expression in each Bioproject

Bar chart with 9 bars.
G2144544 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network