G2144559



Basic Information


Item Value
gene id G2144559
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 5027227 ~ 5028359 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2452589
gcaaaggagcaaaataaataaattaattaaatacagttgggaaagaggtagttgtttgggctaaattataggtgggctatgtacaggtgcagtaatctgtgagctgctctgacagttggtgcttaaagctagtgagggagataagtgtttccagtttcagaaatgtttgtagttcgttccagtcattggcagcagagaactggaaagagaggcggccaaagaaagaattggttttgggggtgactagagagatatacctgctgcgagctgagataaggggggactttacgtagcagggtcttgtagatgacatggagccagtgggtttggcgacgagtatgaagcgagggccagccaacgagagcgtacaggtcgcaatggtgggtagtatatggggctttggtgacaaaacggattgcactgtgatagactgcatccaatttgttgagtagggtattggaggctattttgtaaatgacatcgccaaagtcgaggattggtaggatggtcagttttacaagggtatgtttggcagcatgagtgaaggatgctttgttgcgaaataggaagccaattctagatttaactttggattggagatgtttgatatgggtctggaaggagagtttacagtctaaccagacacctaagtatttgtagttgtccatgtattctaagtcagagccgtccagagtagtgatgttggacaggcgggtaggtgcaggtagcgatcggttgaagagcattaatttagttttacttgtatttaagagcaattggaggtcacggaaggagagttgtatgtcattgaagcttgcctggagggttgttaacacagtgtccaaagaagggccggaagtatacagaatggtgtcgtctgcgtagaggtggatcagagactcaccagcagcaagagcgacctcattgatgtttacagagaagagagtcggtccaagaattgaaccctgtggcacccccatagagactgccagaggtccggacaacagaccctccgatttgacacactgaactctatcagagaagtagttggtgaaccaggcgaggcaatcatttgagaaaccaaggctgttgagtctgccgatgaggatgtggtgattgacagagtcgaaagc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2452589 True 1133 lncRNA 0.46 1 5027227 5028359
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110509535 purg coding downstream 156058 4866710 ~ 4871169 (-)
LOC110509534 LOC105021738 coding downstream 175093 4822193 ~ 4852134 (-)
LOC110509533 LOC106562887 coding downstream 336886 4685524 ~ 4690341 (-)
LOC110509302 psmb7 coding downstream 403791 4620399 ~ 4636327 (-)
LOC118945302 NA coding downstream 798033 4225423 ~ 4229194 (-)
LOC110509538 LOC106562893 coding upstream 40240 5068599 ~ 5124878 (-)
LOC110509542 fbxw2 coding upstream 486532 5514891 ~ 5523585 (-)
LOC118945317 NA coding upstream 613093 5641452 ~ 5641777 (-)
LOC118945316 NA coding upstream 613492 5641851 ~ 5643016 (-)
opi-1 opi-1 coding upstream 628227 5656586 ~ 5658119 (-)
G2144558 NA non-coding downstream 51 5026210 ~ 5027176 (-)
G2144556 LOC106562892 non-coding downstream 5665 5020254 ~ 5021562 (-)
G2144555 NA non-coding downstream 7684 5019280 ~ 5019543 (-)
G2144552 NA non-coding downstream 11748 5014645 ~ 5015479 (-)
G2144550 NA non-coding downstream 14735 5012045 ~ 5012492 (-)
G2144560 NA non-coding upstream 202 5028561 ~ 5029048 (-)
G2144561 NA non-coding upstream 742 5029101 ~ 5029497 (-)
G2144562 NA non-coding upstream 1193 5029552 ~ 5029764 (-)
G2144567 NA non-coding upstream 7176 5035535 ~ 5035740 (-)
G2144503 NA non-coding upstream 15772 5044131 ~ 5044273 (-)
LOC110509531 LOC106570883 other downstream 596691 4208866 ~ 4430679 (-)
G2143134 NA other downstream 1391987 3628165 ~ 3635240 (-)
LOC110509525 LOC106562824 other downstream 1703131 3317596 ~ 3324117 (-)
G2141289 LOC100380853 other downstream 3377496 1649299 ~ 1649731 (-)
G2141258 NA other downstream 3414018 1598021 ~ 1613209 (-)
G2144911 NA other upstream 186724 5215083 ~ 5226311 (-)
G2145316 opi-1 other upstream 613117 5641476 ~ 5672690 (-)
G2145335 NA other upstream 721327 5749686 ~ 5755666 (-)
G2145511 NA other upstream 778706 5807065 ~ 5807624 (-)
G2145604 NA other upstream 1072412 6100771 ~ 6108752 (-)

Expression


G2144559 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G2144559 Expression in each Bioproject

Bar chart with 20 bars.
G2144559 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network