G2145511



Basic Information


Item Value
gene id G2145511
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 5807065 ~ 5807624 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2453713
ggttcaccaattactttgcagacagagttcagtgtgtcaaatcggagggcatgctgtccggtcctctggcagtctctatgggggtgccacagggttcaattctcgggccgactcttttctctgtatatatcaatgatgtttctcatgctgcgggcgattccctgatccacctctacgcagacgacaccattctatatacttccggcccgtccttggacactgtgctatctaacctccaaacgagcttcaatgccatacagcactccttccgtggcctccaactgctcttaaacactagtaaaaccaaatgcatgcttttcaaccgttcgctgcctgcacccgcacgcctgaccagcatcaccaccctggatggttccgaccttgaatatgtggacatctataagtacctaggtgtctggctagactctaaactctccttccagacccatatcaaacatctccaatcgaaaatcaaatcaagagtcggctttctattccgcaacaaagcctcgttcactcacgccgccaaacttaccctagtaaaactgactatcctaccg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2453713 True 560 TUCP 0.49 1 5807065 5807624
Loading

Neighbor


gene id symbol gene type direction distance location
trnaa-cgc-8 NA coding downstream 13300 5793694 ~ 5793765 (-)
trnaa-cgc-7 NA coding downstream 24037 5782957 ~ 5783028 (-)
trnat-ugu-46 NA coding downstream 37351 5769643 ~ 5769714 (-)
trnaa-ugc-222 NA coding downstream 51557 5755437 ~ 5755508 (-)
trnat-cgu-91 NA coding downstream 52074 5754920 ~ 5754991 (-)
LOC110511721 NA coding upstream 19420 5827044 ~ 5827912 (-)
LOC118945579 NA coding upstream 88782 5896406 ~ 5929252 (-)
LOC118945553 NA coding upstream 89279 5896903 ~ 5897084 (-)
LOC110509559 NA coding upstream 773576 6579264 ~ 6594474 (-)
LOC118945709 NA coding upstream 786193 6593817 ~ 6593895 (-)
G2145510 NA non-coding downstream 418 5806254 ~ 5806647 (-)
G2145356 NA non-coding downstream 9720 5794449 ~ 5797345 (-)
G2145328 NA non-coding downstream 18459 5696478 ~ 5788606 (-)
G2145347 NA non-coding downstream 29362 5771389 ~ 5777703 (-)
G2145345 NA non-coding downstream 29910 5770930 ~ 5777155 (-)
G2145512 NA non-coding upstream 1254 5808878 ~ 5809112 (-)
G2145514 NA non-coding upstream 11426 5819050 ~ 5819409 (-)
G2145515 NA non-coding upstream 16391 5824015 ~ 5824247 (-)
G2145516 NA non-coding upstream 18632 5826256 ~ 5826509 (-)
G2145525 NA non-coding upstream 30176 5837800 ~ 5838133 (-)
G2145335 NA other downstream 51399 5749686 ~ 5755666 (-)
G2145316 opi-1 other downstream 134375 5641476 ~ 5672690 (-)
G2144911 NA other downstream 580754 5215083 ~ 5226311 (-)
LOC110509531 LOC106570883 other downstream 1376529 4208866 ~ 4430679 (-)
G2143134 NA other downstream 2171825 3628165 ~ 3635240 (-)
G2145604 NA other upstream 293147 6100771 ~ 6108752 (-)
G2145618 LOC106591448 other upstream 333442 6141066 ~ 6148494 (-)
G2145542 NA other upstream 341952 6137289 ~ 6252866 (-)
G2146036 NA other upstream 841554 6649178 ~ 6649663 (-)

Expression


G2145511 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G2145511 Expression in each Bioproject

Bar chart with 19 bars.
G2145511 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network