G2145604



Basic Information


Item Value
gene id G2145604
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 6100771 ~ 6108752 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2453855
CTACAAGCCGCATGTTTCTGTCTCTCGCATAACAGATGGCATCTCGGATCAGTATCAGGCTGTCCGTGATCTTCCTTCCGGGCACGGCACAGGTTTGGTCCGGGTGGATCACCTCCCCTAAAACAGAAGACATTCTGAGTGTTAAAACCTTGGTAAAAAGTTTACAATCAAAGTTTAAAAGGGTAATCGGTCTCCAGTTTTTCAGGTCCGTCCTGTCGTTTTTCTTATGTAAAAGAGTCACGATCCCCACTCTAAAACTGTCGGGTAGTCTGTCGAGGTGTTCGAAGTCAGTAAAAACAGTCAGAAGTTCGTCGGCTAAAACATCCCAAAAGGTCAGATAAAACTCCAAAGGGAGGCCGTCCTCCCCCGGTGATTTACCCCTCTTAAAACGTTTCAGTCCTTGGTCGATTTCTGTCCTCGTCAGGTCTTTTTTCAGGTCGTCTGTATTGGGTAAGGTCTTGTCGATGTATGTTAAAAGGTCCCCCATTGTTCCCTCGCACACATCTTTTACCCCAAACAGTTCCCCATAAAAGTCCTCGACCACTTCCTTTATTCCCT

Function


NR:

description
reverse transcriptase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2453855 True 558 TUCP 0.46 2 6100771 6108752
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118945553 NA coding downstream 203687 5896903 ~ 5897084 (-)
LOC118945579 NA coding downstream 204249 5896406 ~ 5929252 (-)
LOC110511721 NA coding downstream 272859 5827044 ~ 5827912 (-)
trnaa-cgc-8 NA coding downstream 307006 5793694 ~ 5793765 (-)
trnaa-cgc-7 NA coding downstream 317743 5782957 ~ 5783028 (-)
LOC110509559 NA coding upstream 472448 6579264 ~ 6594474 (-)
LOC118945709 NA coding upstream 485065 6593817 ~ 6593895 (-)
LOC118945279 NA coding upstream 496565 6605317 ~ 6607608 (-)
LOC110509561 LOC106562926 coding upstream 561424 6670176 ~ 6688054 (-)
LOC110509562 LOC106562929 coding upstream 580790 6689542 ~ 6712436 (-)
G2145591 NA non-coding downstream 82377 6013567 ~ 6018394 (-)
G2145550 NA non-coding downstream 128670 5877795 ~ 5972101 (-)
G2145587 NA non-coding downstream 143739 5953302 ~ 5957032 (-)
G2145580 NA non-coding downstream 163398 5929382 ~ 5937373 (-)
G2145614 LOC106586052 non-coding upstream 21497 6130249 ~ 6136885 (-)
G2145542 NA non-coding upstream 28537 6137289 ~ 6252866 (-)
G2145548 NA non-coding upstream 34463 6143215 ~ 6150100 (-)
G2145629 NA non-coding upstream 96527 6205279 ~ 6233514 (-)
G2145543 NA non-coding upstream 130264 6239016 ~ 6285258 (-)
G2145511 NA other downstream 293147 5807065 ~ 5807624 (-)
G2145335 NA other downstream 345105 5749686 ~ 5755666 (-)
G2145316 opi-1 other downstream 428081 5641476 ~ 5672690 (-)
G2144911 NA other downstream 874460 5215083 ~ 5226311 (-)
LOC110509531 LOC106570883 other downstream 1670235 4208866 ~ 4430679 (-)
G2145618 LOC106591448 other upstream 32314 6141066 ~ 6148494 (-)
G2146036 NA other upstream 540426 6649178 ~ 6649663 (-)
LOC110509586 LOC106562956 other upstream 2022031 8130783 ~ 8168089 (-)

Expression


G2145604 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G2145604 Expression in each Bioproject

Bar chart with 19 bars.
G2145604 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network