G2145705



Basic Information


Item Value
gene id G2145705
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 6364310 ~ 6364513 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2453967
actgtaatccactaccctgcctggtctgtagttcgccagatgaggtgtgtaacggaccgtgctgacagactgtaatcccctaccctgcctggtctgtagttcgccaggtgaggtgtgtaacggaccgtgctgacagactgtaatcccctaccctgtctggtctgtagttcgccagatgaggtgtgtaacggaccgtgcggacag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2453967 True 204 lncRNA 0.56 1 6364310 6364513

Neighbor


gene id symbol gene type direction distance location
LOC118945571 NA coding upstream 51257 6312938 ~ 6313053 (+)
LOC118945669 NA coding upstream 53963 6310231 ~ 6310347 (+)
LOC118945566 NA coding upstream 54244 6309887 ~ 6310066 (+)
LOC118945577 NA coding upstream 59709 6304485 ~ 6304601 (+)
LOC118945564 NA coding upstream 61664 6302474 ~ 6302646 (+)
LOC110509560 LOC106562923 coding downstream 234547 6599060 ~ 6622505 (+)
LOC110509307 LOC106562924 coding downstream 276269 6640782 ~ 6664348 (+)
LOC118936374 NA coding downstream 303164 6667677 ~ 6673995 (+)
LOC110509565 LOC105006106 coding downstream 361840 6726353 ~ 6756968 (+)
LOC110509567 LOC106562933 coding downstream 433590 6798103 ~ 6816600 (+)
G2145699 NA non-coding upstream 15235 6347828 ~ 6349075 (+)
G2145696 NA non-coding upstream 17488 6346103 ~ 6346822 (+)
G2145685 NA non-coding upstream 24804 6337871 ~ 6339506 (+)
G2145650 NA non-coding upstream 60052 6304056 ~ 6304258 (+)
LOC118945546 NA non-coding upstream 67296 6278174 ~ 6297190 (+)
G2145706 NA non-coding downstream 165 6364678 ~ 6421803 (+)
G2145716 NA non-coding downstream 62766 6427279 ~ 6427527 (+)
G2145717 NA non-coding downstream 64672 6429185 ~ 6430019 (+)
G2145721 NA non-coding downstream 97964 6462477 ~ 6462857 (+)
G2145723 yo84 non-coding downstream 99030 6463543 ~ 6464041 (+)
LOC118945315 LOC106593246 other upstream 90817 6267751 ~ 6274178 (+)
G2145368 NA other upstream 131812 6188572 ~ 6232498 (+)
G2145469 NA other upstream 144368 6182511 ~ 6219942 (+)
G2145472 LOC106591448 other upstream 169553 6187647 ~ 6194757 (+)
G2145424 NA other upstream 442004 5914627 ~ 5922306 (+)
G2145733 NA other downstream 154177 6518690 ~ 6519140 (+)
G2146821 NA other downstream 1635616 8000129 ~ 8000490 (+)
LOC118945282 NA other downstream 2593290 8957803 ~ 9032295 (+)
G2149183 NA other downstream 3009487 9374000 ~ 9374512 (+)

Expression


G2145705 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G2145705 Expression in each Bioproject

Bar chart with 3 bars.
G2145705 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network