G2146036



Basic Information


Item Value
gene id G2146036
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 6649178 ~ 6649663 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2454332
tgcaaaacgttatgtttggcgtaaaagcaacacagctgaacacaccatccccactctcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaaatccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaatttcagtctctcgatgtgcaaaactgatagacatagcccaagcgacttacag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2454332 True 486 TUCP 0.44 1 6649178 6649663

Neighbor


gene id symbol gene type direction distance location
LOC118945279 NA coding downstream 41570 6605317 ~ 6607608 (-)
LOC110509559 NA coding downstream 54736 6579264 ~ 6594474 (-)
LOC118945709 NA coding downstream 55283 6593817 ~ 6593895 (-)
LOC118945553 NA coding downstream 752094 5896903 ~ 5897084 (-)
LOC118945579 NA coding downstream 752656 5896406 ~ 5929252 (-)
LOC110509561 LOC106562926 coding upstream 20513 6670176 ~ 6688054 (-)
LOC110509562 LOC106562929 coding upstream 39879 6689542 ~ 6712436 (-)
LOC110509564 LOC106562930 coding upstream 106947 6756610 ~ 6763472 (-)
LOC110509566 LOC106562932 coding upstream 117414 6767077 ~ 6771817 (-)
LOC110509308 LOC106563009 coding upstream 262778 6912441 ~ 6943779 (-)
G2146033 NA non-coding downstream 6372 6642380 ~ 6642806 (-)
G2146023 NA non-coding downstream 22580 6625965 ~ 6626598 (-)
G2145970 NA non-coding downstream 71071 6577296 ~ 6578107 (-)
G2145995 NA non-coding downstream 103927 6543343 ~ 6545251 (-)
G2146037 NA non-coding upstream 248 6649911 ~ 6650333 (-)
G2146047 NA non-coding upstream 12180 6661843 ~ 6662157 (-)
G2146049 NA non-coding upstream 15056 6664719 ~ 6665023 (-)
G2146064 NA non-coding upstream 79549 6729212 ~ 6731113 (-)
G2145542 NA other downstream 396312 6137289 ~ 6252866 (-)
G2145618 LOC106591448 other downstream 500684 6141066 ~ 6148494 (-)
G2145604 NA other downstream 540426 6100771 ~ 6108752 (-)
G2145511 NA other downstream 841554 5807065 ~ 5807624 (-)
LOC110509586 LOC106562956 other upstream 1481120 8130783 ~ 8168089 (-)
ttc33 LOC106568686 other upstream 2715549 9365212 ~ 9437537 (-)
G2151189 NA other upstream 4068358 10718021 ~ 10799318 (-)
ttll11 LOC106562979 other upstream 4301586 10923070 ~ 10969315 (-)
G2151771 NA other upstream 4343503 10993166 ~ 10993879 (-)

Expression


G2146036 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G2146036 Expression in each Bioproject

Bar chart with 20 bars.
G2146036 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network