G2148253



Basic Information


Item Value
gene id G2148253
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 8443032 ~ 8529631 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2456711
ccatcaggttttcttccagaatggtcctgtatttggctccatccatctttccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagggtgatgagctgtgttgcttttaagccaaacataacattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacaacac

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2456711 True 289 lncRNA 0.45 3 8443032 8529631
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110509590 LOC106562960 coding downstream 210389 8224378 ~ 8232643 (-)
LOC110509589 LOC106568849 coding downstream 226187 8209282 ~ 8216845 (-)
LOC118945698 NA coding downstream 236558 8206343 ~ 8206474 (-)
LOC118945695 NA coding downstream 237930 8204971 ~ 8205102 (-)
LOC118945696 NA coding downstream 239984 8202919 ~ 8203048 (-)
LOC110509591 LOC106562961 coding upstream 88411 8618042 ~ 8682244 (-)
LOC110509310 LOC106562962 coding upstream 231472 8761103 ~ 8889487 (-)
LOC118945710 NA coding upstream 494164 9023795 ~ 9023922 (-)
LOC110509593 LOC106562963 coding upstream 498515 9028146 ~ 9130315 (-)
LOC110509595 LOC106562965 coding upstream 612358 9141989 ~ 9150865 (-)
G2148048 NA non-coding downstream 236468 8202769 ~ 8206564 (-)
G2148071 NA non-coding downstream 271130 8171685 ~ 8171902 (-)
LOC110509586 LOC106562956 non-coding downstream 307758 8130783 ~ 8168089 (-)
G2148055 NA non-coding downstream 317380 8125066 ~ 8125652 (-)
G2148352 NA non-coding upstream 54926 8584557 ~ 8584921 (-)
G2148371 NA non-coding upstream 82376 8612007 ~ 8612250 (-)
G2148626 NA non-coding upstream 336519 8866150 ~ 8867572 (-)
G2148651 NA non-coding upstream 366417 8896048 ~ 8896515 (-)
G2149023 NA non-coding upstream 627742 9157373 ~ 9157686 (-)
G2146036 NA other downstream 1793369 6649178 ~ 6649663 (-)
LOC110509559 NA other downstream 1848558 6579264 ~ 6594474 (-)
G2145542 NA other downstream 2190166 6137289 ~ 6252866 (-)
G2145618 LOC106591448 other downstream 2294538 6141066 ~ 6148494 (-)
ttc33 LOC106568686 other upstream 835581 9365212 ~ 9437537 (-)
G2151189 NA other upstream 2188390 10718021 ~ 10799318 (-)
ttll11 LOC106562979 other upstream 2421618 10923070 ~ 10969315 (-)
G2151771 NA other upstream 2463535 10993166 ~ 10993879 (-)
LOC100135966 rps27a other upstream 2712363 11241994 ~ 11244060 (-)

Expression


G2148253 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G2148253 Expression in each Bioproject

Bar chart with 19 bars.
G2148253 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network