G2148626



Basic Information


Item Value
gene id G2148626
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 8866150 ~ 8867572 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2457119
ataagagacatccccagtatctctacctgcacattcatcttctgccgatctaccattccagtgtttaattgctatattgtaattacttcgccaccatggcctatttatttccttaacttaccacatttgcactcactgtatatagactttttgttttcttttgttctactgtattattgactgtatgttttgtttattccatgtgtaactctgtgttg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2457119 True 218 lncRNA 0.35 2 8866150 8867572

Neighbor


gene id symbol gene type direction distance location
LOC110509591 LOC106562961 coding downstream 183906 8618042 ~ 8682244 (-)
LOC110509590 LOC106562960 coding downstream 633507 8224378 ~ 8232643 (-)
LOC110509589 LOC106568849 coding downstream 649305 8209282 ~ 8216845 (-)
LOC118945698 NA coding downstream 659676 8206343 ~ 8206474 (-)
LOC118945695 NA coding downstream 661048 8204971 ~ 8205102 (-)
LOC118945710 NA coding upstream 156223 9023795 ~ 9023922 (-)
LOC110509593 LOC106562963 coding upstream 160574 9028146 ~ 9130315 (-)
LOC110509595 LOC106562965 coding upstream 274417 9141989 ~ 9150865 (-)
ptcd2 ptcd2 coding upstream 298668 9166240 ~ 9170359 (-)
LOC110509597 LOC106562968 coding upstream 309597 9177157 ~ 9241546 (-)
G2148371 NA non-coding downstream 253900 8612007 ~ 8612250 (-)
G2148352 NA non-coding downstream 281229 8584557 ~ 8584921 (-)
G2148253 NA non-coding downstream 336519 8443032 ~ 8529631 (-)
G2148247 NA non-coding downstream 401432 8433546 ~ 8464718 (-)
G2148651 NA non-coding upstream 28476 8896048 ~ 8896515 (-)
G2149023 NA non-coding upstream 289801 9157373 ~ 9157686 (-)
G2149040 NA non-coding upstream 328184 9195756 ~ 9195974 (-)
G2149050 NA non-coding upstream 338800 9206372 ~ 9257290 (-)
LOC110509586 LOC106562956 other downstream 698119 8130783 ~ 8168089 (-)
G2146036 NA other downstream 2216487 6649178 ~ 6649663 (-)
LOC110509559 NA other downstream 2271676 6579264 ~ 6594474 (-)
G2145542 NA other downstream 2613284 6137289 ~ 6252866 (-)
G2145618 LOC106591448 other downstream 2717656 6141066 ~ 6148494 (-)
ttc33 LOC106568686 other upstream 497640 9365212 ~ 9437537 (-)
G2151189 NA other upstream 1850449 10718021 ~ 10799318 (-)
ttll11 LOC106562979 other upstream 2083677 10923070 ~ 10969315 (-)
G2151771 NA other upstream 2125594 10993166 ~ 10993879 (-)
LOC100135966 rps27a other upstream 2374422 11241994 ~ 11244060 (-)

Expression


G2148626 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G2148626 Expression in each Bioproject

Bar chart with 16 bars.
G2148626 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network