G2149183



Basic Information


Item Value
gene id G2149183
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 9374000 ~ 9374512 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2457713
attttttgcagtgtgactccattaagtgtgtgtgtgtgtgtgtgtgtgtgtgtgtagattaaacatgaacgggccaaaacggacatggcagcaggtcaaaatcaaatacaagaacattctgcagaatgcagtgaaaaagaatacccacagacaaggcacgggtggtgggtcatcaaaggctgaccttaccccagcagaggacatggccttggagctaaataaaggcaggcccgtcttagaggggatccctggggggaaagagacgagcataggttcctcccaagatgccacccgcttcattcaagtgtctggcagcactgtgttcctgttagagcc

Function


NR:

description
uncharacterized protein LOC110536099 isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2457713 True 336 TUCP 0.50 3 9374000 9374512
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110509598 pe2r4 coding upstream 7482 9309984 ~ 9366518 (+)
LOC118945275 LOC107691784 coding upstream 164171 9209358 ~ 9209829 (+)
LOC110509594 rexo4 coding upstream 232629 9137291 ~ 9141371 (+)
LOC118945282 NA coding upstream 344163 8957803 ~ 9032295 (+)
LOC110509587 fa69b coding upstream 1172640 8173842 ~ 8201360 (+)
LOC110509604 LOC106562973 coding downstream 689655 10064167 ~ 10309768 (+)
zgc:63972 LOC106562974 coding downstream 1098920 10473432 ~ 10496533 (+)
si:dkeyp-72a4.1 LOC106562976 coding downstream 1231643 10606155 ~ 10618148 (+)
LOC110509315 LOC106562976 coding downstream 1326542 10701054 ~ 10906165 (+)
LOC110509607 LOC106562980 coding downstream 1599930 10974442 ~ 11003230 (+)
G2148870 NA non-coding upstream 172433 9201113 ~ 9201567 (+)
G2148857 LOC106562968 non-coding upstream 193059 9180704 ~ 9180941 (+)
G2148827 NA non-coding upstream 193511 9177170 ~ 9180489 (+)
G2148856 NA non-coding upstream 197777 9176010 ~ 9176223 (+)
G2149242 NA non-coding downstream 79142 9453654 ~ 9457539 (+)
G2149334 LOC106562972 non-coding downstream 242901 9617413 ~ 9617782 (+)
G2149335 NA non-coding downstream 244125 9618637 ~ 9619279 (+)
G2149459 NA non-coding downstream 407753 9782265 ~ 9782604 (+)
G2150621 NA non-coding downstream 1012013 10386525 ~ 10386756 (+)
G2146821 NA other upstream 1373510 8000129 ~ 8000490 (+)
LOC110509307 LOC106562924 other upstream 2715476 6640782 ~ 6664348 (+)
G2145733 NA other upstream 2854860 6518690 ~ 6519140 (+)
LOC118945315 LOC106593246 other upstream 3100507 6267751 ~ 6274178 (+)
G2150729 NA other downstream 1087241 10461753 ~ 10462220 (+)
G2151555 NA other downstream 1985873 11359557 ~ 11432252 (+)
G2152150 NA other downstream 2389712 11764224 ~ 11766351 (+)
G2152639 NA other downstream 2926280 12300792 ~ 12307438 (+)

Expression


G2149183 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G2149183 Expression in each Bioproject

Bar chart with 14 bars.
G2149183 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6.
End of interactive chart.

Co-expression Network