G2152639



Basic Information


Item Value
gene id G2152639
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 12300792 ~ 12307438 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2461440
TGAGCTGACCAAAGCCAATTAATTACATGTTTTTGCATGCAAGATTTGATGTGTATAATGTGATTGACTCCATTGTTATTGATGGTTGTGTTCGTAGGTTGGAAATCAACCCTATAGTTGTCACTGGAGTCTTCAAGCACACCTGTATGAATAAGGCAACAGGTCCTGATGACATCTCTGCTTTTCTTCTAAAAACATGTGCAGAGGAACTGACTATGGCAATGTTATTCACACTGTACACAAACGAATGCACTAGACTAATCCTGATAATTATATTGTCAACTTTTCTGATGATACCGGCATTTTTGGTCTGCTGTATAAAGATGCTGAAACTGCTGTGTACAGGTCAGAGATTCAAAAAAGTTAGTCAAGCGGTGTGATGAGAACCATCTCAATGTTAATGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2461440 True 404 TUCP 0.38 2 12300792 12307438
Loading

Neighbor


gene id symbol gene type direction distance location
actr1 LOC106563059 coding upstream 86074 12206283 ~ 12214718 (+)
stc1l LOC106563064 coding upstream 156521 12142150 ~ 12144271 (+)
LOC110509641 LOC106563065 coding upstream 158734 12128086 ~ 12142058 (+)
zgc:100918 LOC105015198 coding upstream 174566 12116644 ~ 12126226 (+)
wdr45 wdr45 coding upstream 184312 12113136 ~ 12116480 (+)
tcf7l1a LOC106563056 coding downstream 21314 12328752 ~ 12353472 (+)
dusp11 dusp11 coding downstream 58104 12365542 ~ 12372347 (+)
atp6v1b2 LOC106563054 coding downstream 69626 12377064 ~ 12394568 (+)
LOC110509656 NA coding downstream 131144 12438582 ~ 12445321 (+)
LOC110509661 LOC106563047 coding downstream 710615 13018053 ~ 13088171 (+)
G2152621 NA non-coding upstream 25111 12275440 ~ 12275681 (+)
G2152608 NA non-coding upstream 43914 12256622 ~ 12256878 (+)
G2152603 LOC106563058 non-coding upstream 58064 12242189 ~ 12242728 (+)
G2152602 LOC106563058 non-coding upstream 58815 12241506 ~ 12241977 (+)
G2152590 NA non-coding upstream 64994 12230415 ~ 12235798 (+)
G2152642 NA non-coding downstream 111 12307549 ~ 12307749 (+)
G2152645 NA non-coding downstream 4468 12311906 ~ 12312161 (+)
G2152646 LOC106567989 non-coding downstream 5705 12313143 ~ 12343582 (+)
G2152715 NA non-coding downstream 169553 12476991 ~ 12477389 (+)
G2152741 NA non-coding downstream 246144 12553582 ~ 12558205 (+)
G2152150 NA other upstream 534441 11764224 ~ 11766351 (+)
G2151555 NA other upstream 934300 11359557 ~ 11432252 (+)
G2150729 NA other upstream 1838572 10461753 ~ 10462220 (+)
LOC110509604 LOC106562973 other upstream 1991713 10064167 ~ 10309768 (+)
G2149183 NA other upstream 2926280 9374000 ~ 9374512 (+)
G2153316 NA other downstream 452442 12759880 ~ 12760490 (+)
G2154294 NA other downstream 1360851 13668289 ~ 13669170 (+)
G2154391 NA other downstream 1465270 13772708 ~ 13776134 (+)
G2154438 NA other downstream 1498575 13806013 ~ 13813970 (+)
G2154512 NA other downstream 1625810 13915670 ~ 13935819 (+)

Expression


G2152639 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G2152639 Expression in each Bioproject

Bar chart with 7 bars.
G2152639 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network