G2153316



Basic Information


Item Value
gene id G2153316
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 12759880 ~ 12760490 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2462149
actttactcaaaccagtgaatatcacttattataaatgagatcattaactatcagctcttggaatatccagggcctatactcttcacattttggttataaaacaactaatccagaattgattaaaaacatcaagggacaggacatcataatcctactggaaacatggtgtcgtggagacatagatactcagtgtccctcaggctatagagaaagtttactaccatcaatcaaacataaaaatgttaaacggggccgagactcaggtggaatcatcatttggcataagcaggacttagcaatgaatgaaatgaaaaaaggtaccactcacatttggctaaaacttaacaaaggtacaatctattgtgacaatgatgtatacatatgtgcagcttatgctcctccttcagattcatcatattatgatgatcagttttttgacaatctccagacagaaatcattacatttcaggcgcagggtaaagtgcttctttgtggagatttcaatgcaagaacaggttctgagcctgactacactgatgcgggaggtaaccaccacatatttggacacccctccttgtacagtagccctattataaataatagaaacagt

Function


NR:

description
PREDICTED: uncharacterized protein LOC109105496

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2462149 True 611 TUCP 0.38 1 12759880 12760490

Neighbor


gene id symbol gene type direction distance location
LOC110509656 NA coding upstream 314559 12438582 ~ 12445321 (+)
atp6v1b2 LOC106563054 coding upstream 365312 12377064 ~ 12394568 (+)
dusp11 dusp11 coding upstream 387533 12365542 ~ 12372347 (+)
tcf7l1a LOC106563056 coding upstream 406408 12328752 ~ 12353472 (+)
actr1 LOC106563059 coding upstream 545162 12206283 ~ 12214718 (+)
LOC110509661 LOC106563047 coding downstream 257563 13018053 ~ 13088171 (+)
LOC110509665 NA coding downstream 465917 13226407 ~ 13230321 (+)
arsb arsb coding downstream 473981 13234471 ~ 13259942 (+)
LOC110509667 LOC106563044 coding downstream 502176 13262666 ~ 13336582 (+)
LOC110509669 LOC106563041 coding downstream 616812 13377302 ~ 13442767 (+)
G2153310 NA non-coding upstream 144 12751320 ~ 12759736 (+)
G2153307 NA non-coding upstream 12004 12747654 ~ 12747876 (+)
G2153212 NA non-coding upstream 86436 12673156 ~ 12673444 (+)
G2153177 NA non-coding upstream 108311 12651166 ~ 12651569 (+)
G2153175 NA non-coding upstream 109384 12650140 ~ 12650496 (+)
G2153400 NA non-coding downstream 87206 12847696 ~ 12848285 (+)
G2153402 NA non-coding downstream 98275 12858765 ~ 12859894 (+)
G2153459 NA non-coding downstream 185091 12945581 ~ 12945786 (+)
G2153473 NA non-coding downstream 211835 12972325 ~ 12972555 (+)
G2153480 LOC106563050 non-coding downstream 228609 12989099 ~ 13001821 (+)
G2152639 NA other upstream 452442 12300792 ~ 12307438 (+)
G2152150 NA other upstream 993529 11764224 ~ 11766351 (+)
G2151555 NA other upstream 1393388 11359557 ~ 11432252 (+)
G2150729 NA other upstream 2297660 10461753 ~ 10462220 (+)
LOC110509604 LOC106562973 other upstream 2450801 10064167 ~ 10309768 (+)
G2154294 NA other downstream 907799 13668289 ~ 13669170 (+)
G2154391 NA other downstream 1012218 13772708 ~ 13776134 (+)
G2154438 NA other downstream 1045523 13806013 ~ 13813970 (+)
G2154512 NA other downstream 1172758 13915670 ~ 13935819 (+)
G2155696 NA other downstream 2258137 15018627 ~ 15093949 (+)

Expression


G2153316 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G2153316 Expression in each Bioproject

Bar chart with 13 bars.
G2153316 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network