G2154533



Basic Information


Item Value
gene id G2154533
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 13946469 ~ 13981651 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2463469
attcggcccccttgaactttgcgaccttttgccacatttcaggcttcaaacataaagatataaaactgtatttttttgtgaagaatcaacaagtgggacacaatcatgaagtgcaacgacatttattggatatttcaaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagcccccttaagttaatactttgtagcgccaccttttgctgcgattacagctgtaagtcgcttggggtatgtctctatcagttttgcacatcgagagactgaaat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2463469 True 292 lncRNA 0.38 2 13946469 13981651

Neighbor


gene id symbol gene type direction distance location
LOC110509328 LOC106563105 coding upstream 4041 13940187 ~ 13942428 (+)
LOC110509678 LOC106563033 coding upstream 163764 13779399 ~ 13782705 (+)
LOC110509676 NA coding upstream 199010 13745413 ~ 13747459 (+)
LOC110509673 LOC106563107 coding upstream 215358 13728812 ~ 13731111 (+)
crf-bp crf-bp coding upstream 248983 13678513 ~ 13697486 (+)
atp6v1g1 LOC106563029 coding downstream 18603 14000254 ~ 14010168 (+)
slc31a1 LOC106563027 coding downstream 33391 14015042 ~ 14028322 (+)
prpf4 prpf4 coding downstream 53671 14035322 ~ 14041282 (+)
LOC118945712 NA coding downstream 57685 14039336 ~ 14039471 (+)
LOC118945711 NA coding downstream 58783 14040434 ~ 14040567 (+)
G2154512 NA non-coding upstream 10650 13915670 ~ 13935819 (+)
G2154396 NA non-coding upstream 159754 13786515 ~ 13786715 (+)
G2154384 NA non-coding upstream 179900 13766276 ~ 13766569 (+)
G2154379 NA non-coding upstream 193795 13752324 ~ 13752674 (+)
G2154564 NA non-coding downstream 31230 14012881 ~ 14013081 (+)
G2154565 NA non-coding downstream 31565 14013216 ~ 14013423 (+)
G2154573 NA non-coding downstream 62519 14044170 ~ 14044421 (+)
G2154574 NA non-coding downstream 62802 14044453 ~ 14044814 (+)
G2154575 NA non-coding downstream 63314 14044965 ~ 14045498 (+)
G2154438 NA other upstream 132499 13806013 ~ 13813970 (+)
G2154391 NA other upstream 170335 13772708 ~ 13776134 (+)
G2154294 NA other upstream 277299 13668289 ~ 13669170 (+)
G2153316 NA other upstream 1185979 12759880 ~ 12760490 (+)
G2155696 NA other downstream 1036976 15018627 ~ 15093949 (+)
G2157602 NA other downstream 2369066 16350717 ~ 16353665 (+)
G2158499 LOC106563144 other downstream 3207693 17189344 ~ 17191128 (+)
LOC110509751 LOC106563328 other downstream 5078892 18962089 ~ 19065920 (+)
LOC118945267 NA other downstream 5084527 19066137 ~ 19068784 (+)

Expression


G2154533 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 125.
End of interactive chart.

G2154533 Expression in each Bioproject

Bar chart with 17 bars.
G2154533 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network