G2154714



Basic Information


Item Value
gene id G2154714
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 14012592 ~ 14013092 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2463662
gcactcacaaacttctacagatgcacaatcgagagcatcctgtcgggctgtatcaccgcctgttacggcaactgctccgcccacaaccataaggctctccagagggtagtgaggtctgcacaacgcatcaccgggggcaaactacctgccctccaggacacctgcaccacccggtgtcacaggaaggccataaagatcatcaaggacaacaaccacccaagccactgcctgttcaccccgctatcatccagaaggcgaggtcagtacaggtgcatcaaagctgggaccgagagactgaaaaacagcttatatctcaaggccatcaaactgttaaacagccaccactaacattgagtgtctgctgccaacacactgactcaactccagccactttaatgatgggaattgatgtaaaatatatcactagcaacttgaaacaatgctacttaatataatgtttacataccctacattatttatctcatatatatatatatgtat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2463662 True 501 lncRNA 0.47 1 14012592 14013092

Neighbor


gene id symbol gene type direction distance location
LOC110509679 NA coding downstream 76313 13933407 ~ 13936279 (-)
LOC110509327 LOC106563032 coding downstream 142722 13807407 ~ 13869870 (-)
LOC110509677 LOC106563034 coding downstream 255071 13753775 ~ 13757521 (-)
LOC110509675 par-2 coding downstream 260405 13747735 ~ 13752187 (-)
f2rl1.2 par2 coding downstream 267268 13742537 ~ 13745324 (-)
cdc26 cdc26 coding upstream 15218 14028310 ~ 14030112 (-)
si:ch211-202f5.2 LOC106563026 coding upstream 28157 14041249 ~ 14045646 (-)
si:ch211-202f5.3 LOC106563025 coding upstream 41238 14054254 ~ 14056905 (-)
pisd LOC106563023 coding upstream 51519 14064611 ~ 14114275 (-)
wu:fi75a02 LOC106563022 coding upstream 108948 14122040 ~ 14148522 (-)
G2154713 NA non-coding downstream 1955 14010432 ~ 14010637 (-)
G2154671 NA non-coding downstream 60180 13951585 ~ 13952412 (-)
G2154419 NA non-coding downstream 228810 13783333 ~ 13783782 (-)
G2154404 NA non-coding downstream 238363 13773742 ~ 13774229 (-)
G2154409 NA non-coding downstream 251673 13760591 ~ 13760919 (-)
G2154719 NA non-coding upstream 1990 14015082 ~ 14015321 (-)
G2154721 NA non-coding upstream 4615 14017707 ~ 14017977 (-)
G2154722 NA non-coding upstream 4912 14018004 ~ 14018335 (-)
G2154723 NA non-coding upstream 19483 14032575 ~ 14032822 (-)
G2154724 NA non-coding upstream 21532 14034624 ~ 14034865 (-)
G2154637 NA other downstream 2425 14000525 ~ 14010167 (-)
G2154418 LOC106563033 other downstream 230338 13780659 ~ 13782254 (-)
G2154361 LOC106563107 other downstream 281496 13728833 ~ 13731096 (-)
G2153683 NA other downstream 921236 13087453 ~ 13091356 (-)
G2153174 NA other downstream 1363097 12649176 ~ 12649495 (-)
G2155063 LOC106563020 other upstream 210029 14223121 ~ 14223931 (-)
G2155120 NA other upstream 214728 14227820 ~ 14231006 (-)
G2157715 NA other upstream 2368098 16381190 ~ 16386045 (-)

Expression


G2154714 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G2154714 Expression in each Bioproject

Bar chart with 20 bars.
G2154714 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network