G2154573



Basic Information


Item Value
gene id G2154573
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 14044170 ~ 14044421 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2463514
GAGGATGGTGTCGAGGCGTCTCAGGCAGGCTTGGCAGAAGGTGTGGCTGCAGTAGAGCTTGCGTGGCAGCCTCTCAGTCAGGTTGAAGGCACAGTAGCAGATGATACAGTCCAGTTTACGGCTGTCTCTGGATGGCTGAACTCCTCCGGCCTCCACATCACCCTCTACTGGGGGATCTTCTGGGGCCCCTAGGTCAGGGGCCTCTGCTGGGTCCTCTGGGACAGGAAAGTCTGGGGCATCAGGAACTGGGGC

Function


NR:

description
RING finger protein 224-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2463514 True 252 lncRNA 0.60 1 14044170 14044421
Loading

Neighbor


gene id symbol gene type direction distance location
prpf4 prpf4 coding upstream 2888 14035322 ~ 14041282 (+)
LOC118945711 NA coding upstream 3603 14040434 ~ 14040567 (+)
LOC118945712 NA coding upstream 4699 14039336 ~ 14039471 (+)
slc31a1 LOC106563027 coding upstream 15848 14015042 ~ 14028322 (+)
atp6v1g1 LOC106563029 coding upstream 34002 14000254 ~ 14010168 (+)
LOC110509688 LOC106563021 coding downstream 127378 14171799 ~ 14175996 (+)
LOC110509690 LOC106563020 coding downstream 170701 14215122 ~ 14231240 (+)
LOC110509691 LOC106563019 coding downstream 244791 14289212 ~ 14396808 (+)
LOC110509696 LOC106563151 coding downstream 741566 14785987 ~ 14806264 (+)
LOC110509698 NA coding downstream 831296 14875717 ~ 14879923 (+)
G2154565 NA non-coding upstream 30747 14013216 ~ 14013423 (+)
G2154564 NA non-coding upstream 31089 14012881 ~ 14013081 (+)
G2154533 NA non-coding upstream 62519 13946469 ~ 13981651 (+)
G2154512 NA non-coding upstream 108351 13915670 ~ 13935819 (+)
G2154396 NA non-coding upstream 257455 13786515 ~ 13786715 (+)
G2154574 NA non-coding downstream 32 14044453 ~ 14044814 (+)
G2154575 NA non-coding downstream 544 14044965 ~ 14045498 (+)
G2154750 LOC106563023 non-coding downstream 25832 14070253 ~ 14071153 (+)
G2154823 NA non-coding downstream 156462 14200883 ~ 14201383 (+)
G2154438 NA other upstream 230200 13806013 ~ 13813970 (+)
G2154391 NA other upstream 268036 13772708 ~ 13776134 (+)
G2154294 NA other upstream 375000 13668289 ~ 13669170 (+)
G2153316 NA other upstream 1283680 12759880 ~ 12760490 (+)
G2155696 NA other downstream 974206 15018627 ~ 15093949 (+)
G2157602 NA other downstream 2306296 16350717 ~ 16353665 (+)
G2158499 LOC106563144 other downstream 3144923 17189344 ~ 17191128 (+)
LOC110509751 LOC106563328 other downstream 5016122 18962089 ~ 19065920 (+)
LOC118945267 NA other downstream 5021757 19066137 ~ 19068784 (+)

Expression


G2154573 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

G2154573 Expression in each Bioproject

Bar chart with 4 bars.
G2154573 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6.
End of interactive chart.

Co-expression Network