G2157552



Basic Information


Item Value
gene id G2157552
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 16287939 ~ 16288170 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2466729
tacagtggggcaataaagtatttaatcagccaccaattgggcaagttctcccacttaaaaagttgagagagtcctgtaatttatcataagtacacttcaactatgacagacaaaattagcattttttttctccagaaaatcacactgtaggatttttaatttatttatttgcaaattatggtggaaaataagtatttggtcaataacaaaagtttatctcaatactttgtta

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2466729 True 232 lncRNA 0.30 1 16287939 16288170
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110509706 LOC106563136 coding downstream 270440 15970492 ~ 16017499 (-)
LOC110509703 LOC106563138 coding downstream 862631 15105979 ~ 15425308 (-)
LOC110509702 LOC106563139 coding downstream 1210929 15038817 ~ 15087213 (-)
LOC110509700 LOC106563141 coding downstream 1287348 14973955 ~ 15000591 (-)
LOC110509329 NA coding downstream 1340825 14945612 ~ 14947114 (-)
stxbp1a LOC106563129 coding upstream 370216 16658386 ~ 16701533 (-)
slc31a2 copt2 coding upstream 477175 16765345 ~ 16776377 (-)
LOC110509719 fut7 coding upstream 570750 16858920 ~ 16866531 (-)
LOC110509724 LOC106563119 coding upstream 778192 17066362 ~ 17093537 (-)
LOC110509723 LOC106563118 coding upstream 805886 17094056 ~ 17135891 (-)
G2157547 LOC106563134 non-coding downstream 6455 16281260 ~ 16281484 (-)
G2157544 LOC106563134 non-coding downstream 12050 16275551 ~ 16275889 (-)
G2157391 NA non-coding downstream 256548 16030978 ~ 16031391 (-)
G2157383 NA non-coding downstream 266328 16021401 ~ 16021611 (-)
G2157057 NA non-coding downstream 403625 15884092 ~ 15884314 (-)
G2157764 NA non-coding upstream 159541 16447711 ~ 16451774 (-)
G2158016 LOC106563130 non-coding upstream 173234 16461404 ~ 16463045 (-)
G2158021 NA non-coding upstream 183580 16471750 ~ 16472039 (-)
G2158022 NA non-coding upstream 184283 16472453 ~ 16472660 (-)
G2158027 NA non-coding upstream 192190 16480360 ~ 16480587 (-)
G2155120 NA other downstream 2056933 14227820 ~ 14231006 (-)
G2155063 LOC106563020 other downstream 2064008 14223121 ~ 14223931 (-)
si:ch211-202f5.3 LOC106563025 other downstream 2231060 14054254 ~ 14056905 (-)
cdc26 cdc26 other downstream 2258169 14028310 ~ 14030112 (-)
G2154637 NA other downstream 2277772 14000525 ~ 14010167 (-)
G2157715 NA other upstream 93020 16381190 ~ 16386045 (-)
G2157743 NA other upstream 133507 16421677 ~ 16423421 (-)
G2158088 LOC100136012 other upstream 319455 16607625 ~ 16608006 (-)
G2158111 akna other upstream 355511 16643681 ~ 16646597 (-)
LOC110509757 LOC106563370 other upstream 2988098 19275539 ~ 19277044 (-)

Expression


G2157552 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G2157552 Expression in each Bioproject

Bar chart with 10 bars.
G2157552 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network