G2157715



Basic Information


Item Value
gene id G2157715
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 16381190 ~ 16386045 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2466897
ggcacagacctgtggaagggtaccaaaacatttctgcagcattgaaggtccccaagaacacagtggcttccatcattcttaaatggaagaagtttggaaccacccggccaaactgagcaatcgggggagaagggccttggtcagggacatgaccaagaacccgatggtcactctgacaaagctccagagttcctctgtggagatgggagaaccttccagaagaacaaccatctctgcagcactccaccaatcaggcctttatggtagagtggccagacggaagccactcctcagtaaaaggaacatgacagcctgcttggagtttgccaaaaggcccctgaagaactctcagaccatgagaaacaagattctctggtctgatg

Function


NR:

description
Transposase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2466897 True 383 TUCP 0.51 2 16381190 16386045
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110509706 LOC106563136 coding downstream 363691 15970492 ~ 16017499 (-)
LOC110509703 LOC106563138 coding downstream 955882 15105979 ~ 15425308 (-)
LOC110509702 LOC106563139 coding downstream 1304180 15038817 ~ 15087213 (-)
LOC110509700 LOC106563141 coding downstream 1380599 14973955 ~ 15000591 (-)
LOC110509329 NA coding downstream 1434076 14945612 ~ 14947114 (-)
stxbp1a LOC106563129 coding upstream 272341 16658386 ~ 16701533 (-)
slc31a2 copt2 coding upstream 379300 16765345 ~ 16776377 (-)
LOC110509719 fut7 coding upstream 472875 16858920 ~ 16866531 (-)
LOC110509724 LOC106563119 coding upstream 680317 17066362 ~ 17093537 (-)
LOC110509723 LOC106563118 coding upstream 708011 17094056 ~ 17135891 (-)
G2157552 NA non-coding downstream 93020 16287939 ~ 16288170 (-)
G2157547 LOC106563134 non-coding downstream 99706 16281260 ~ 16281484 (-)
G2157544 LOC106563134 non-coding downstream 105301 16275551 ~ 16275889 (-)
G2157391 NA non-coding downstream 349799 16030978 ~ 16031391 (-)
G2157383 NA non-coding downstream 359579 16021401 ~ 16021611 (-)
G2157764 NA non-coding upstream 61666 16447711 ~ 16451774 (-)
G2158016 LOC106563130 non-coding upstream 75359 16461404 ~ 16463045 (-)
G2158021 NA non-coding upstream 85705 16471750 ~ 16472039 (-)
G2158022 NA non-coding upstream 86408 16472453 ~ 16472660 (-)
G2158027 NA non-coding upstream 94315 16480360 ~ 16480587 (-)
G2155120 NA other downstream 2150184 14227820 ~ 14231006 (-)
G2155063 LOC106563020 other downstream 2157259 14223121 ~ 14223931 (-)
si:ch211-202f5.3 LOC106563025 other downstream 2324311 14054254 ~ 14056905 (-)
cdc26 cdc26 other downstream 2351420 14028310 ~ 14030112 (-)
G2154637 NA other downstream 2371023 14000525 ~ 14010167 (-)
G2157743 NA other upstream 35632 16421677 ~ 16423421 (-)
G2158088 LOC100136012 other upstream 221580 16607625 ~ 16608006 (-)
G2158111 akna other upstream 257636 16643681 ~ 16646597 (-)
LOC110509757 LOC106563370 other upstream 2890223 19275539 ~ 19277044 (-)
G2162005 NA other upstream 3598500 19984545 ~ 19984779 (-)

Expression


G2157715 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G2157715 Expression in each Bioproject

Bar chart with 21 bars.
G2157715 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network