G2159795



Basic Information


Item Value
gene id G2159795
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 18156051 ~ 18156258 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2469155
ataatatttcaaccggacaataacgtcgtcaatataaaaggtaaacaaaaaaggcactctctcggtcgtgcgcataaaaaagctctgtgacacggcagggtccactcattcagacagcttttactccctcatttttcagaatacaagcctgaaacaatttctaaagactgttgacatctagtggaaggcataggaactgcaatttgag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2469155 True 208 lncRNA 0.40 1 18156051 18156258

Neighbor


gene id symbol gene type direction distance location
arpc3 arpc3 coding upstream 736822 17416053 ~ 17419229 (+)
LOC110509733 LOC106566318 coding upstream 740112 17412561 ~ 17415939 (+)
LOC110509732 vps29 coding upstream 749746 17400243 ~ 17406305 (+)
LOC110509337 noc4l coding upstream 756627 17395850 ~ 17399424 (+)
LOC110509731 LOC106563154 coding upstream 761685 17391095 ~ 17394366 (+)
LOC110509739 LOC106563160 coding downstream 119685 18275943 ~ 18282836 (+)
LOC110509741 LOC106563161 coding downstream 132480 18288738 ~ 18380940 (+)
si:dkey-1d7.3 LOC106563162 coding downstream 236681 18392939 ~ 18442193 (+)
LOC110509745 LOC106563165 coding downstream 610221 18766479 ~ 18783952 (+)
LOC110509747 LOC106563168 coding downstream 652554 18808812 ~ 18823742 (+)
G2159794 NA non-coding upstream 580 18155256 ~ 18155471 (+)
G2159791 NA non-coding upstream 2239 18153431 ~ 18153812 (+)
G2159785 NA non-coding upstream 9149 18146646 ~ 18146902 (+)
G2159710 NA non-coding upstream 66533 18089116 ~ 18089518 (+)
G2159688 NA non-coding upstream 83297 18072436 ~ 18072754 (+)
G2159808 NA non-coding downstream 8154 18164412 ~ 18164624 (+)
G2159829 NA non-coding downstream 24758 18181016 ~ 18181347 (+)
G2159873 NA non-coding downstream 230733 18386991 ~ 18389764 (+)
G2160139 NA non-coding downstream 290056 18446314 ~ 18446621 (+)
G2160145 NA non-coding downstream 301868 18458126 ~ 18458362 (+)
G2158499 LOC106563144 other upstream 964923 17189344 ~ 17191128 (+)
G2157602 NA other upstream 1802386 16350717 ~ 16353665 (+)
G2155696 NA other upstream 3062102 15018627 ~ 15093949 (+)
G2154512 NA other upstream 4220232 13915670 ~ 13935819 (+)
G2154438 NA other upstream 4342081 13806013 ~ 13813970 (+)
LOC110509751 LOC106563328 other downstream 904285 18962089 ~ 19065920 (+)
LOC118945267 NA other downstream 909920 19066137 ~ 19068784 (+)
LOC110509753 LOC106563373 other downstream 980411 19136428 ~ 19138160 (+)
LOC110509766 LOC106566689 other downstream 1454631 19609602 ~ 19616511 (+)
G2161635 LOC106563312 other downstream 1585556 19741814 ~ 19752743 (+)

Expression


G2159795 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G2159795 Expression in each Bioproject

Bar chart with 20 bars.
G2159795 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network