G2161975



Basic Information


Item Value
gene id G2161975
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 19952311 ~ 19952624 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2471595
acgacccgaaacacacagccagggcaactaaggagtggctccgtaagaagcatctcaaggtcctggagtggcctagccagtctccagacctgaacccaatagaacatctttggagggagctgaaagtccgtattgcccagcgacagccccgaaacctgaaggatctggagaaggtctgtatggaggagtgggccaaaatccctgctgcagtgtgtgcaaacctggtcaagaactacaggaaacgtatgatctctgtaattgcaaacaaaggtttctgtaccaaatattaagttctgcttttctgatgtatcaag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2471595 True 314 lncRNA 0.49 1 19952311 19952624
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110509780 LOC106563302 coding downstream 1687 19946567 ~ 19950624 (-)
traf2 LOC106563303 coding downstream 46438 19882762 ~ 19905873 (-)
LOC110509775 LOC106563308 coding downstream 111627 19837235 ~ 19840684 (-)
LOC110509773 LOC106563311 coding downstream 117042 19807260 ~ 19835269 (-)
LOC110509772 LOC106563313 coding downstream 159417 19780056 ~ 19792894 (-)
LOC110509785 LOC106563298 coding upstream 70504 20023128 ~ 20025908 (-)
LOC110509787 LOC106563295 coding upstream 98171 20050795 ~ 20063783 (-)
LOC110509788 LOC106563294 coding upstream 135601 20088225 ~ 20093695 (-)
lman2la lman2l coding upstream 186332 20138956 ~ 20143762 (-)
LOC110509794 ddx54 coding upstream 809037 20761661 ~ 20772043 (-)
G2161972 NA non-coding downstream 7231 19944805 ~ 19945080 (-)
G2161970 NA non-coding downstream 10368 19941606 ~ 19941943 (-)
G2161969 NA non-coding downstream 11925 19940140 ~ 19940386 (-)
G2161908 NA non-coding downstream 69716 19882068 ~ 19882595 (-)
G2161904 NA non-coding downstream 70706 19879833 ~ 19881605 (-)
G2161978 NA non-coding upstream 3283 19955907 ~ 19956217 (-)
G2161992 NA non-coding upstream 21249 19973873 ~ 19974155 (-)
G2162004 NA non-coding upstream 31600 19984224 ~ 19984509 (-)
G2162013 NA non-coding upstream 36855 19989479 ~ 19989868 (-)
G2162014 NA non-coding upstream 37275 19989899 ~ 19990316 (-)
LOC110509757 LOC106563370 other downstream 675305 19275539 ~ 19277044 (-)
G2158111 akna other downstream 3305714 16643681 ~ 16646597 (-)
G2158088 LOC100136012 other downstream 3344305 16607625 ~ 16608006 (-)
G2157743 NA other downstream 3528890 16421677 ~ 16423421 (-)
G2157715 NA other downstream 3566266 16381190 ~ 16386045 (-)
G2162005 NA other upstream 31921 19984545 ~ 19984779 (-)
G2162127 NA other upstream 130521 20083145 ~ 20083618 (-)
G2162405 LOC106563289 other upstream 356565 20309189 ~ 20309802 (-)
G2162422 LOC106563345 other upstream 377124 20329748 ~ 20330138 (-)

Expression


G2161975 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 75.
End of interactive chart.

G2161975 Expression in each Bioproject

Bar chart with 21 bars.
G2161975 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3000.
End of interactive chart.

Co-expression Network