G2162137



Basic Information


Item Value
gene id G2162137
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 20100143 ~ 20100359 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2471789
ctttgaagtaaaactgtttgaatgatgtctgtgagtataacagaactcatatggcaggcaaaaacctgagaaaaaaatccaaccaggaagtgggaaatctgaggtttgtagttttttccaagtcattgcctattgaatatacagtgtctatgggttcatattgcacttcctacggcttccactaaatgtcaacagtctttaaaaccttgtttgaggc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2471789 True 217 lncRNA 0.38 1 20100143 20100359
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110509788 LOC106563294 coding downstream 6448 20088225 ~ 20093695 (-)
LOC110509787 LOC106563295 coding downstream 36360 20050795 ~ 20063783 (-)
LOC110509785 LOC106563298 coding downstream 74235 20023128 ~ 20025908 (-)
LOC110509780 LOC106563302 coding downstream 149519 19946567 ~ 19950624 (-)
traf2 LOC106563303 coding downstream 194270 19882762 ~ 19905873 (-)
lman2la lman2l coding upstream 38597 20138956 ~ 20143762 (-)
LOC110509794 ddx54 coding upstream 661302 20761661 ~ 20772043 (-)
LOC110509795 LOC106563284 coding upstream 711377 20811736 ~ 20869832 (-)
LOC110509797 exos2 coding upstream 771113 20871472 ~ 20878088 (-)
LOC110509798 LOC106563283 coding upstream 780055 20880412 ~ 20885181 (-)
G2162136 NA non-coding downstream 394 20099545 ~ 20099749 (-)
G2162126 NA non-coding downstream 17139 20082762 ~ 20083004 (-)
G2162100 LOC106563296 non-coding downstream 69183 20029093 ~ 20030960 (-)
G2162098 NA non-coding downstream 72851 20027001 ~ 20027292 (-)
G2162097 NA non-coding downstream 77109 20022702 ~ 20023034 (-)
G2162150 NA non-coding upstream 7675 20108034 ~ 20108286 (-)
G2162160 NA non-coding upstream 15935 20116294 ~ 20117019 (-)
G2162186 NA non-coding upstream 25848 20126207 ~ 20126461 (-)
G2162182 NA non-coding upstream 36456 20136815 ~ 20137734 (-)
G2162197 NA non-coding upstream 52254 20152613 ~ 20152830 (-)
G2162127 NA other downstream 16525 20083145 ~ 20083618 (-)
G2162005 NA other downstream 115364 19984545 ~ 19984779 (-)
LOC110509757 LOC106563370 other downstream 823137 19275539 ~ 19277044 (-)
G2158111 akna other downstream 3453546 16643681 ~ 16646597 (-)
G2162405 LOC106563289 other upstream 208830 20309189 ~ 20309802 (-)
G2162422 LOC106563345 other upstream 229389 20329748 ~ 20330138 (-)
surf4 LOC106563281 other upstream 869973 20970332 ~ 20978032 (-)
rabepk rabepk other upstream 1044790 21138218 ~ 21146494 (-)
G2163913 NA other upstream 1496192 21596551 ~ 21597495 (-)

Expression


G2162137 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G2162137 Expression in each Bioproject

Bar chart with 16 bars.
G2162137 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network