G2162714



Basic Information


Item Value
gene id G2162714
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 20584220 ~ 20584424 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2472407
cctacctcatccccatactgtttttatttatttatttttctgctcttttgcacaccaatatctctacctgtacataaccatcggatcatttatcactccagtgttaatctgcataattgtaattattcgcctaccttctcatgccttttgcacacaatgtatatagactccccttttttctactgtgttattgacttgttaattg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2472407 True 205 lncRNA 0.35 1 20584220 20584424
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110509342 LOC106563289 coding upstream 261184 20216712 ~ 20323036 (+)
LOC110509341 LOC106566934 coding upstream 402931 20173189 ~ 20181289 (+)
wbp1 LOC106563291 coding upstream 452839 20120015 ~ 20131381 (+)
LOC110509784 LOC106563296 coding upstream 541782 20025913 ~ 20042438 (+)
LOC110509783 LOC106563299 coding upstream 572831 19995364 ~ 20011389 (+)
LOC110509791 LOC106563287 coding downstream 52140 20636564 ~ 20646034 (+)
LOC110509792 LOC106563286 coding downstream 108487 20692911 ~ 20712554 (+)
rab14l LOC106563285 coding downstream 209458 20793882 ~ 20811225 (+)
cyh9orf16 cssa11h9orf16 coding downstream 399039 20983463 ~ 20985277 (+)
dnm1a dnm1 coding downstream 419825 21004249 ~ 21096175 (+)
G2162702 NA non-coding upstream 9350 20574636 ~ 20574870 (+)
G2162701 NA non-coding upstream 9598 20574263 ~ 20574622 (+)
G2162681 NA non-coding upstream 25405 20558582 ~ 20558815 (+)
G2162676 NA non-coding upstream 29886 20554005 ~ 20554334 (+)
G2162675 NA non-coding upstream 30301 20553688 ~ 20553919 (+)
G2162721 NA non-coding downstream 6543 20590967 ~ 20591214 (+)
G2162853 NA non-coding downstream 94068 20678492 ~ 20679138 (+)
G2162978 NA non-coding downstream 295990 20880414 ~ 20880989 (+)
G2162904 NA non-coding downstream 387838 20972262 ~ 20973279 (+)
G2163071 NA non-coding downstream 488173 21072597 ~ 21077941 (+)
G2161678 NA other upstream 786446 19795260 ~ 19797774 (+)
G2161635 LOC106563312 other upstream 831477 19741814 ~ 19752743 (+)
LOC110509766 LOC106566689 other upstream 967709 19609602 ~ 19616511 (+)
LOC110509753 LOC106563373 other upstream 1446652 19136428 ~ 19138160 (+)
LOC118945267 NA other upstream 1515436 19066137 ~ 19068784 (+)
LOC110509811 LOC106563272 other downstream 613494 21160126 ~ 21389662 (+)
G2163804 LOC106613263 other downstream 1015994 21600418 ~ 21601052 (+)
G2165628 LOC106563266 other downstream 2252647 22837071 ~ 22841481 (+)
G2165973 LOC106563265 other downstream 2541356 23125780 ~ 23134290 (+)
LOC110509345 LOC106563260 other downstream 2931198 23468400 ~ 23534217 (+)

Expression


G2162714 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G2162714 Expression in each Bioproject

Bar chart with 8 bars.
G2162714 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network