G2162853


Basic Information

Item Value
gene id G2162853
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 20678492 ~ 20679138 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2472557
gaatctcatcctttacctctgcgcggagaccctccagaagacgagcgagcaaggccggctcgttccagccactggagacagcaagagtgcgaaactcaatagagtagtctgttatggatcgattgccttgacatagggcagacagggccctggaagcctcctccccaaaaacagatcgatcaaaaacccgtatcatctcctccttaaagtcctgatactggttagtacactcagcccttgcctcccagattgccgtgccccactcacgagcccgtccaataaggagagatatgacgtaggcgacacgagcagtgctcctggagtaagtgttgggctggagagaaaacacaatatcacactgggtgaggaacgagcggcattcagtgggctccccagagtaacacggcgggttattgattctgggctccggagattcgaaagccctggaagtggccggtggatcgaggcggagatggtgaacctgttctgtgaggttggagacttgggtggccagggtctcaacggcatgtcgagcagcagacacttcctgctcgtgtctgcctagcatcgctccctggatcccgacggctgagtggagaggatccgaagtcgctgggtccattcttggtcggattcttctgttatgg

Function

NR:

description
PREDICTED: protein LDOC1-like, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2472557 True 647 lncRNA 0.55 1 20678492 20679138

Neighbor

gene id symbol gene type direction distance location
LOC110509791 LOC106563287 coding upstream 32458 20636564 ~ 20646034 (+)
LOC110509342 LOC106563289 coding upstream 355456 20216712 ~ 20323036 (+)
LOC110509341 LOC106566934 coding upstream 497203 20173189 ~ 20181289 (+)
wbp1 LOC106563291 coding upstream 547111 20120015 ~ 20131381 (+)
LOC110509784 LOC106563296 coding upstream 636054 20025913 ~ 20042438 (+)
LOC110509792 LOC106563286 coding downstream 13773 20692911 ~ 20712554 (+)
rab14l LOC106563285 coding downstream 114744 20793882 ~ 20811225 (+)
cyh9orf16 cssa11h9orf16 coding downstream 304325 20983463 ~ 20985277 (+)
dnm1a dnm1 coding downstream 325111 21004249 ~ 21096175 (+)
LOC100135840 grp78 coding downstream 454271 21133409 ~ 21137594 (+)
G2162721 NA non-coding upstream 87278 20590967 ~ 20591214 (+)
G2162714 NA non-coding upstream 94068 20584220 ~ 20584424 (+)
G2162702 NA non-coding upstream 103622 20574636 ~ 20574870 (+)
G2162701 NA non-coding upstream 103870 20574263 ~ 20574622 (+)
G2162681 NA non-coding upstream 119677 20558582 ~ 20558815 (+)
G2162978 NA non-coding downstream 201276 20880414 ~ 20880989 (+)
G2162904 NA non-coding downstream 293124 20972262 ~ 20973279 (+)
G2163071 NA non-coding downstream 393459 21072597 ~ 21077941 (+)
G2163023 NA non-coding downstream 448332 21127470 ~ 21132783 (+)
G2163083 rabepk non-coding downstream 463746 21142884 ~ 21146376 (+)
G2161678 NA other upstream 880718 19795260 ~ 19797774 (+)
G2161635 LOC106563312 other upstream 925749 19741814 ~ 19752743 (+)
LOC110509766 LOC106566689 other upstream 1061981 19609602 ~ 19616511 (+)
LOC110509753 LOC106563373 other upstream 1540924 19136428 ~ 19138160 (+)
LOC118945267 NA other upstream 1609708 19066137 ~ 19068784 (+)
LOC110509811 LOC106563272 other downstream 518780 21160126 ~ 21389662 (+)
G2163804 LOC106613263 other downstream 921280 21600418 ~ 21601052 (+)
G2165628 LOC106563266 other downstream 2157933 22837071 ~ 22841481 (+)
G2165973 LOC106563265 other downstream 2446642 23125780 ~ 23134290 (+)
LOC110509345 LOC106563260 other downstream 2836484 23468400 ~ 23534217 (+)

Expression

G2162853 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G2162853 Expression in each Bioproject

Bar chart with 20 bars.
G2162853 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network