G2163927



Basic Information


Item Value
gene id G2163927
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 21617706 ~ 21617934 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2473708
aaatgttatttgtcacatacacatggttagcagatgttaatgcgagtgtagcgaaatgcttgtgcttatagttccgacaatacagtaataaccaacaagtaatctagctaacaattccaaaactactaccttatagacacaagtgtaaggggataaagaatatgtacataaagatatatgagtgagtacagagcggcataggcaagatacagtagatggtattgagtgc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2473708 True 229 lncRNA 0.36 1 21617706 21617934
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118945362 NA coding downstream 92193 21519877 ~ 21525513 (-)
rabepk rabepk coding downstream 471212 21138218 ~ 21146494 (-)
LOC110509343 NA coding downstream 489742 21124159 ~ 21132785 (-)
golga2 golga2 coding downstream 495697 21096285 ~ 21122009 (-)
ciz1a ciz1 coding downstream 619609 20985126 ~ 20998097 (-)
LOC110509815 LOC106563268 coding upstream 261693 21879566 ~ 22337506 (-)
LOC110509818 LOC104924185 coding upstream 975667 22593601 ~ 22594656 (-)
LOC110509819 LOC106563266 coding upstream 1219120 22837054 ~ 22957768 (-)
LOC110509820 LOC106563265 coding upstream 1508676 23126610 ~ 23169638 (-)
LOC110509821 kad coding upstream 1563421 23181355 ~ 23191969 (-)
G2163919 NA non-coding downstream 13608 21603819 ~ 21604098 (-)
G2163916 NA non-coding downstream 16335 21601119 ~ 21601371 (-)
G2163912 NA non-coding downstream 21930 21594883 ~ 21595776 (-)
G2163881 NA non-coding downstream 35919 21542412 ~ 21581787 (-)
G2163903 NA non-coding downstream 38380 21578822 ~ 21579326 (-)
G2163928 NA non-coding upstream 1276 21619210 ~ 21619522 (-)
G2163943 NA non-coding upstream 14088 21632022 ~ 21632240 (-)
G2164540 LOC106563270 non-coding upstream 150748 21768682 ~ 21768975 (-)
G2164542 NA non-coding upstream 152150 21770084 ~ 21770294 (-)
G2164555 LOC106563270 non-coding upstream 164511 21782445 ~ 21782700 (-)
G2163923 NA other downstream 4745 21612563 ~ 21612961 (-)
G2163913 NA other downstream 20211 21596551 ~ 21597495 (-)
surf4 LOC106563281 other downstream 640758 20970332 ~ 20978032 (-)
G2162422 LOC106563345 other downstream 1287568 20329748 ~ 20330138 (-)
LOC110509827 LOC106563259 other upstream 1923208 23540883 ~ 23552798 (-)
LOC110509849 enp2 other upstream 2665616 24231769 ~ 24286433 (-)
LOC110509347 LOC106565457 other upstream 2782915 24400755 ~ 24407113 (-)
LOC110509858 LOC106563233 other upstream 2912256 24530156 ~ 24537449 (-)
G2167965 LOC106563228 other upstream 3229219 24847153 ~ 24869810 (-)

Expression


G2163927 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G2163927 Expression in each Bioproject

Bar chart with 13 bars.
G2163927 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network