G2163943



Basic Information


Item Value
gene id G2163943
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 21632022 ~ 21632240 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2473724
ggggagaaccggttgaaagtttctgtcggctgaatgagtgacaccggttgagcattcctacagcatttccttccagaagccatgagaaaattgtccggctgcggggactgtgcgaggggatttatactaacgttacaatctgtacttactggtggcacagacgctgtttcatcctttcctacactgaaattaccattgcctaacgattgcgtctgaagc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2473724 True 219 lncRNA 0.48 1 21632022 21632240
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118945362 NA coding downstream 106509 21519877 ~ 21525513 (-)
rabepk rabepk coding downstream 485528 21138218 ~ 21146494 (-)
LOC110509343 NA coding downstream 504058 21124159 ~ 21132785 (-)
golga2 golga2 coding downstream 510013 21096285 ~ 21122009 (-)
ciz1a ciz1 coding downstream 633925 20985126 ~ 20998097 (-)
LOC110509815 LOC106563268 coding upstream 247387 21879566 ~ 22337506 (-)
LOC110509818 LOC104924185 coding upstream 961361 22593601 ~ 22594656 (-)
LOC110509819 LOC106563266 coding upstream 1204814 22837054 ~ 22957768 (-)
LOC110509820 LOC106563265 coding upstream 1494370 23126610 ~ 23169638 (-)
LOC110509821 kad coding upstream 1549115 23181355 ~ 23191969 (-)
G2163928 NA non-coding downstream 12500 21619210 ~ 21619522 (-)
G2163927 NA non-coding downstream 14088 21617706 ~ 21617934 (-)
G2163919 NA non-coding downstream 27924 21603819 ~ 21604098 (-)
G2163916 NA non-coding downstream 30651 21601119 ~ 21601371 (-)
G2163912 NA non-coding downstream 36246 21594883 ~ 21595776 (-)
G2164540 LOC106563270 non-coding upstream 136442 21768682 ~ 21768975 (-)
G2164542 NA non-coding upstream 137844 21770084 ~ 21770294 (-)
G2164555 LOC106563270 non-coding upstream 150205 21782445 ~ 21782700 (-)
G2164579 NA non-coding upstream 218024 21850264 ~ 21850582 (-)
G2164584 NA non-coding upstream 228478 21860718 ~ 21860941 (-)
G2163923 NA other downstream 19061 21612563 ~ 21612961 (-)
G2163913 NA other downstream 34527 21596551 ~ 21597495 (-)
surf4 LOC106563281 other downstream 655074 20970332 ~ 20978032 (-)
G2162422 LOC106563345 other downstream 1301884 20329748 ~ 20330138 (-)
LOC110509827 LOC106563259 other upstream 1908902 23540883 ~ 23552798 (-)
LOC110509849 enp2 other upstream 2651310 24231769 ~ 24286433 (-)
LOC110509347 LOC106565457 other upstream 2768609 24400755 ~ 24407113 (-)
LOC110509858 LOC106563233 other upstream 2897950 24530156 ~ 24537449 (-)
G2167965 LOC106563228 other upstream 3214913 24847153 ~ 24869810 (-)

Expression


G2163943 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G2163943 Expression in each Bioproject

Bar chart with 18 bars.
G2163943 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network