G2170077 (LOC106593572)



Basic Information


Item Value
gene id G2170077
gene name LOC106593572
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 26545150 ~ 26545493 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2480215
ctcgcggtttatacaatgacgcggctaatttatggatttttcccgctttcacaagattcatgccgccaaaaaactgagcaccgtcacataatgtgacgtaaatcgagcgcgctcaaacttcccatcattctgattacggtagtcattttgtcaccctcatcatggcaaagacacggagaaatgcatatgatgcagctttcaagttgaaggcgatcgatctggctgttggaaaaggaaatagagctgctgcatgggagcttggccttaatgagtcgatgataagacgttggaaacagcagcgtgaggaactgactcagtgcaaaaagacaacaaaagctttcaga

Function


NR:

description
PREDICTED: uncharacterized protein LOC106593572 isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2480215 True 344 lncRNA 0.45 1 26545150 26545493

Neighbor


gene id symbol gene type direction distance location
LOC110509877 LOC106563217 coding upstream 12353 26504919 ~ 26532797 (+)
LOC110509876 LOC106563358 coding upstream 80535 26463263 ~ 26464615 (+)
LOC110509874 LOC106563218 coding upstream 281247 26123905 ~ 26263903 (+)
LOC110509870 LOC106563360 coding upstream 973957 25567526 ~ 25571193 (+)
trnat-ugu-47 NA coding upstream 1399238 25145843 ~ 25145912 (+)
LOC110509878 LOC106563216 coding downstream 11311 26556804 ~ 26566726 (+)
LOC110509879 LOC106563215 coding downstream 23854 26569347 ~ 26699137 (+)
LOC110509881 LOC106563214 coding downstream 154280 26699773 ~ 26720454 (+)
LOC110509880 LOC106563212 coding downstream 175080 26720573 ~ 26730554 (+)
LOC110509887 LOC106563206 coding downstream 352457 26897950 ~ 26936831 (+)
G2169992 NA non-coding upstream 352 26544496 ~ 26544798 (+)
G2169865 NA non-coding upstream 154515 26390387 ~ 26390635 (+)
G2169839 NA non-coding upstream 176789 26368119 ~ 26368361 (+)
G2169807 NA non-coding upstream 196974 26347971 ~ 26348176 (+)
G2169803 NA non-coding upstream 200477 26344429 ~ 26344673 (+)
G2170078 NA non-coding downstream 344 26545837 ~ 26546045 (+)
G2170111 NA non-coding downstream 33903 26579396 ~ 26579675 (+)
G2170112 NA non-coding downstream 34323 26579816 ~ 26580127 (+)
G2170114 NA non-coding downstream 36180 26581673 ~ 26581947 (+)
G2170116 NA non-coding downstream 40889 26586382 ~ 26586606 (+)
LOC110509866 LOC106563223 other upstream 1342509 24944825 ~ 25202836 (+)
LOC110509859 LOC106563234 other upstream 2012996 24500361 ~ 24532163 (+)
LOC110509837 LOC106563250 other upstream 2753486 23785060 ~ 23793640 (+)
G2170458 LOC106563185 other downstream 776612 27322105 ~ 27324765 (+)
gigyf1b LOC105024601 other downstream 1757712 28277874 ~ 28313151 (+)
LOC110509373 LOC106563396 other downstream 2133355 28678848 ~ 28681351 (+)
G2173098 NA other downstream 3014077 29559570 ~ 29559959 (+)
G2173114 NA other downstream 3040101 29585594 ~ 29587472 (+)

Expression


G2170077(LOC106593572) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G2170077(LOC106593572) Expression in each Bioproject

Bar chart with 20 bars.
G2170077(LOC106593572) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network