G2170175



Basic Information


Item Value
gene id G2170175
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 26758295 ~ 26797557 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2480343
aaataaaagcctgaaactatgtctaaagactgttcacaccatggggaagccataggaaaagtaatctggtttatatccctttaaatggagcgaaggcaggcaatggaacagagagctttcaggaaaaacagcacttcctggttggattttcctcaggttttcgcctgcaatatcagttctgttatacgcacagacaatattttgacagttttggaaactttagagtgttttctatcataaactgacaaatata

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2480343 True 253 lncRNA 0.38 2 26758295 26797557
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110509880 LOC106563212 coding upstream 27741 26720573 ~ 26730554 (+)
LOC110509881 LOC106563214 coding upstream 37841 26699773 ~ 26720454 (+)
LOC110509879 LOC106563215 coding upstream 59158 26569347 ~ 26699137 (+)
LOC110509878 LOC106563216 coding upstream 191569 26556804 ~ 26566726 (+)
LOC110509877 LOC106563217 coding upstream 225498 26504919 ~ 26532797 (+)
LOC110509887 LOC106563206 coding downstream 100393 26897950 ~ 26936831 (+)
LOC110509890 LOC106563202 coding downstream 222670 27020227 ~ 27056214 (+)
LOC110509891 drg1 coding downstream 259024 27056581 ~ 27072987 (+)
LOC110509893 LOC106563198 coding downstream 315929 27113486 ~ 27132244 (+)
LOC110509895 fam136a coding downstream 347787 27145344 ~ 27147704 (+)
G2170155 NA non-coding upstream 102793 26655298 ~ 26655502 (+)
G2170151 NA non-coding upstream 108771 26649303 ~ 26649524 (+)
G2170147 NA non-coding upstream 121728 26636348 ~ 26636567 (+)
G2170145 NA non-coding upstream 123144 26634875 ~ 26635151 (+)
G2170143 NA non-coding upstream 124110 26633972 ~ 26634185 (+)
G2170251 NA non-coding downstream 65599 26863156 ~ 26863436 (+)
G2170211 NA non-coding downstream 71067 26868624 ~ 26869912 (+)
G2170255 NA non-coding downstream 82325 26879882 ~ 26880168 (+)
G2170287 NA non-coding downstream 152603 26950160 ~ 26953340 (+)
G2170289 NA non-coding downstream 158140 26955697 ~ 26968734 (+)
LOC110509876 LOC106563358 other upstream 293734 26463263 ~ 26464615 (+)
LOC110509866 LOC106563223 other upstream 1555654 24944825 ~ 25202836 (+)
LOC110509859 LOC106563234 other upstream 2226141 24500361 ~ 24532163 (+)
LOC110509837 LOC106563250 other upstream 2966631 23785060 ~ 23793640 (+)
G2170458 LOC106563185 other downstream 524548 27322105 ~ 27324765 (+)
gigyf1b LOC105024601 other downstream 1505648 28277874 ~ 28313151 (+)
LOC110509373 LOC106563396 other downstream 1881291 28678848 ~ 28681351 (+)
G2173098 NA other downstream 2762013 29559570 ~ 29559959 (+)
G2173114 NA other downstream 2788037 29585594 ~ 29587472 (+)

Expression


G2170175 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G2170175 Expression in each Bioproject

Bar chart with 20 bars.
G2170175 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network