G2174391



Basic Information


Item Value
gene id G2174391
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 30553683 ~ 30556812 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2485216
cacggacaaactgaattggtccacccacacagacagcgttgtgaagaaggcgcagcagcacctcttcaacctcaggaggctgaagaaattcggcttgtcaccaaaagcactcacaaacttctacagatgcacaatcgagaacatcctgtcgggcagtatcactgcctggtacggcaactgctccgcccacaaccgtaaggctctccagagggtagtgaggtctacacaacgcatcaccgggggcaaactacctgccctccaggacacctacaccacccgatgtcacaggaaggccataaagatcatcaaggacaacaacc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2485216 True 320 lncRNA 0.54 2 30553683 30556812

Neighbor


gene id symbol gene type direction distance location
LOC110510017 LOC106563443 coding downstream 2387 30549215 ~ 30551296 (-)
LOC110510015 LOC106563445 coding downstream 18312 30527165 ~ 30535371 (-)
si:ch1073-224n8.1 LOC106563446 coding downstream 39614 30449003 ~ 30514069 (-)
LOC110510013 LOC106563447 coding downstream 50521 30456185 ~ 30503162 (-)
LOC110510012 LOC106563448 coding downstream 116140 30336845 ~ 30437543 (-)
klhl13 LOC106563441 coding upstream 18581 30575393 ~ 30651448 (-)
LOC110510021 LOC106563440 coding upstream 112780 30669592 ~ 30681307 (-)
LOC110510023 tmm47 coding upstream 289030 30845842 ~ 30863487 (-)
LOC110509413 LOC106563430 coding upstream 503459 31060271 ~ 31191126 (-)
LOC110509414 LOC106563553 coding upstream 646781 31203593 ~ 31204637 (-)
G2174388 NA non-coding downstream 7386 30546056 ~ 30546297 (-)
G2174369 NA non-coding downstream 42008 30511419 ~ 30511675 (-)
G2174338 NA non-coding downstream 108228 30445204 ~ 30445455 (-)
LOC110510011 LOC106563449 non-coding downstream 230984 30319685 ~ 30332728 (-)
G2174414 NA non-coding upstream 29986 30586798 ~ 30588133 (-)
G2174418 NA non-coding upstream 44008 30600820 ~ 30601213 (-)
G2174430 NA non-coding upstream 60221 30617033 ~ 30617606 (-)
G2174510 NA non-coding upstream 189943 30746755 ~ 30749655 (-)
G2174512 NA non-coding upstream 192978 30749790 ~ 30792403 (-)
LOC110510010 requ other downstream 240902 30299615 ~ 30312873 (-)
G2174100 NA other downstream 576116 29975363 ~ 29977567 (-)
G2174066 NA other downstream 608265 29944465 ~ 29945418 (-)
G2173258 LOC106563498 other downstream 1125816 29424723 ~ 29427867 (-)
G2172414 NA other downstream 1733174 28819750 ~ 28820509 (-)
G2174463 NA other upstream 115778 30672590 ~ 30673101 (-)
G2174894 NA other upstream 446943 31003755 ~ 31006435 (-)
G2175135 NA other upstream 963240 31520052 ~ 31521188 (-)
G2175418 LOC106563537 other upstream 1045637 31602449 ~ 31688677 (-)
G2175420 NA other upstream 1112522 31669334 ~ 31673189 (-)

Expression


G2174391 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G2174391 Expression in each Bioproject

Bar chart with 19 bars.
G2174391 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network