G2177340



Basic Information


Item Value
gene id G2177340
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 34196332 ~ 34196814 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2488756
CAGAACACACTAATACATAAATTTAGTCTCCTCTAGCCTCAGTTCCCCCCCACGCTGTCTTGGCCAGAACACACTAATACATTAATTTAGTCTCCTCTAGCCTCAGTTCCCCCCACGATGTCTTGGCCAGAACACACTAATACATTCATTCAGTCTCCTCTAGACTCAGTTCCCCCCACGATGTCTTGGCCAGAACACACTAATACATTCATTTAGTC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2488756 True 218 lncRNA 0.45 2 34196332 34196814
Loading

Neighbor


gene id symbol gene type direction distance location
pacs1a LOC106563701 coding upstream 1115 34178831 ~ 34195217 (+)
bbs1 bbs1 coding upstream 32382 34156709 ~ 34163950 (+)
cfbl cfb coding upstream 40893 34145403 ~ 34155439 (+)
LOC110510125 LOC106563697 coding upstream 60779 34105921 ~ 34135553 (+)
LOC110510124 LOC106602987 coding upstream 107268 33845835 ~ 34089064 (+)
LOC110510132 rin1 coding downstream 30493 34227307 ~ 34236487 (+)
LOC110510134 LOC106563705 coding downstream 82798 34279612 ~ 34290554 (+)
LOC110509380 NA coding downstream 103071 34299885 ~ 34303347 (+)
LOC110510136 LOC106602966 coding downstream 132367 34329181 ~ 34335741 (+)
LOC118945289 NA coding downstream 197176 34393990 ~ 34397166 (+)
G2177301 NA non-coding upstream 100344 34084804 ~ 34095988 (+)
G2177149 NA non-coding upstream 346853 33849088 ~ 33849479 (+)
G2177134 NA non-coding upstream 373702 33822402 ~ 33822630 (+)
G2177132 NA non-coding upstream 375130 33820931 ~ 33821202 (+)
G2177128 NA non-coding upstream 382771 33813354 ~ 33813561 (+)
G2177365 NA non-coding downstream 53880 34250694 ~ 34250973 (+)
G2177367 NA non-coding downstream 55367 34252181 ~ 34252783 (+)
G2177368 NA non-coding downstream 56012 34252826 ~ 34253102 (+)
G2177371 NA non-coding downstream 60167 34256981 ~ 34257207 (+)
cxxc5a LOC106563628 other upstream 960797 33212994 ~ 33235535 (+)
LOC110509425 LOC106563572 other upstream 2070254 32115629 ~ 32150579 (+)
G2175413 NA other upstream 2158596 32037047 ~ 32037736 (+)
LOC110509422 LOC106563560 other upstream 2295096 31820484 ~ 31908546 (+)
G2177424 NA other downstream 162810 34359624 ~ 34460769 (+)
LOC110510159 LOC106563679 other downstream 606125 34784319 ~ 34825545 (+)
ndufa2 ndua2 other downstream 1309034 35505848 ~ 35507048 (+)
G2179418 NA other downstream 1654840 35851654 ~ 35856462 (+)

Expression


G2177340 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G2177340 Expression in each Bioproject

Bar chart with 6 bars.
G2177340 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network