G2182539



Basic Information


Item Value
gene id G2182539
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 38941881 ~ 38942703 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2495019
accctctggagagccttacggttgtgggcggagcagttgccgtaccaggcggtgatacagcccgacaggatgctctcgattgtgcatctgtagaaatttgtgagtgcttttggtgacaagccgaatttcttcagcctcctgagattgaagaggcgctgctgcgccttcttcacgatgctgtctgcatgggtggaccaattcagtttgtctgtgatgtgtacgccgaggaacttaacttactaccctctccactactgttccatcgatgtggataggggggtgttccctctgctgtttcctgaagtccacaatcatctccttagttttgttgacgttgagtgtgaggttattttcctgacaccacactccgagggccctcacctcctccctgtaggccgtctcgtcgttgttggtaatcaagcctaccactgttgtgtcgtccgcaaacttgatgtttgagttggaggcgtgcgtggccacgcagtcgtgggtgaacagggagtacaggagagggctcagaacgcacccttgtggggccccagtgttgaggatcagcggggtggagatgttgttgcctaccctcaccacctgggggcggcccgtcaggaagtccagtacccagttgcacagggcggggttgagacccagggtctcgagcttgatgacgagcttggagggcactatggtgttaaatgccgagctgtagtcgatgaacagcattctcacataggtattcctcttgtccagatgggttagggcagtgtggttgagattgcatcgtctgtggacctatttgggcggtaaacaaattggagtgggtcta

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2495019 True 823 lncRNA 0.54 1 38941881 38942703

Neighbor


gene id symbol gene type direction distance location
LOC118945332 NA coding upstream 67306 38872990 ~ 38874575 (+)
alox5ap flap coding upstream 113778 38821895 ~ 38828103 (+)
LOC110509461 uspl1 coding upstream 122850 38760853 ~ 38819031 (+)
LOC110509435 LOC106604014 coding upstream 292855 38641718 ~ 38649055 (+)
LOC110509433 LOC106563807 coding upstream 317309 38604915 ~ 38624572 (+)
LOC110510244 rxfp2 coding downstream 134558 39077261 ~ 39261772 (+)
LOC110509459 NA coding downstream 418217 39360920 ~ 39361495 (+)
zar1l zar1l coding downstream 428754 39371457 ~ 39373863 (+)
pds5b NA coding downstream 688561 39631264 ~ 39730848 (+)
LOC110521971 LOC106593185 coding downstream 801769 39744472 ~ 39748560 (+)
G2182538 NA non-coding upstream 55 38941594 ~ 38941826 (+)
G2182530 NA non-coding upstream 7742 38933809 ~ 38934139 (+)
G2182521 NA non-coding upstream 14037 38927530 ~ 38927844 (+)
G2182510 NA non-coding upstream 25706 38915946 ~ 38916175 (+)
G2182500 NA non-coding upstream 34355 38907323 ~ 38907526 (+)
G2182556 NA non-coding downstream 10831 38953534 ~ 38955021 (+)
G2182559 NA non-coding downstream 14422 38957125 ~ 38957330 (+)
G2182572 NA non-coding downstream 31078 38973781 ~ 38974008 (+)
G2182653 NA non-coding downstream 187903 39130606 ~ 39131436 (+)
G2182719 NA non-coding downstream 274953 39217656 ~ 39217894 (+)
G2181669 NA other upstream 757009 38174056 ~ 38184872 (+)
G2180928 NA other upstream 1236152 37705148 ~ 37705729 (+)
G2180897 NA other upstream 1279666 37660587 ~ 37662215 (+)
G2180811 NA other upstream 1520534 37417417 ~ 37468092 (+)
G2182716 NA other downstream 266802 39209505 ~ 39210312 (+)
G2183108 NA other downstream 617707 39560410 ~ 39563368 (+)
LOC110521967 LOC106595695 other downstream 810334 39753017 ~ 39778819 (+)
stard13a stard13 other downstream 973455 39862811 ~ 39986975 (+)

Expression


G2182539 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G2182539 Expression in each Bioproject

Bar chart with 20 bars.
G2182539 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network