G2186289



Basic Information


Item Value
gene id G2186289
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 43560617 ~ 43560910 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2499726
CTCAGCGTTACCTAGAACCGAGCCAGGTCACCTAGAACCGAGCCAGGTCACCTAGAACCGAGCCAGGTCAACTAGAACCGAGCCAGATCACCTAGAACCGAGCCAGGTCACCTAGAACCGAGCCAGGTCACCTAGAACCGAGCCAGGTCACCTAGAACCGAGCCAGGTCACCTAGAACCGAGCCAGGTCACCATTGGAAAACCAGAAATGGACG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2499726 True 214 TUCP 0.57 3 43560617 43560910

Neighbor


gene id symbol gene type direction distance location
cct8 cct8 coding upstream 23944 43517321 ~ 43536673 (+)
LOC118945338 NA coding upstream 31248 43527499 ~ 43529369 (+)
grik1a LOC105026052 coding upstream 138911 43328743 ~ 43422689 (+)
trnal-cag-32 NA coding upstream 234939 43325596 ~ 43325678 (+)
trnal-cag-31 NA coding upstream 236463 43324072 ~ 43324154 (+)
gbe1a gbe1 coding downstream 1357466 44918376 ~ 45083739 (+)
mtus2a LOC106563907 coding downstream 1643647 45204557 ~ 45377103 (+)
LOC110518300 NA coding downstream 1827926 45383333 ~ 45391063 (+)
LOC110517637 LOC106563928 coding downstream 1848219 45409129 ~ 45422914 (+)
LOC118945264 NA coding downstream 1917279 45477230 ~ 45480543 (+)
G2186277 NA non-coding upstream 30976 43526833 ~ 43529641 (+)
G2186267 NA non-coding upstream 45074 43509929 ~ 43515543 (+)
G2186257 NA non-coding upstream 65435 43494814 ~ 43495182 (+)
G2186238 NA non-coding upstream 102894 43457333 ~ 43457723 (+)
G2186234 NA non-coding upstream 108013 43452071 ~ 43452604 (+)
G2186298 NA non-coding downstream 32296 43593206 ~ 43593602 (+)
G2186299 NA non-coding downstream 36899 43597809 ~ 43598083 (+)
G2186342 NA non-coding downstream 107773 43668683 ~ 43670150 (+)
G2186344 NA non-coding downstream 116658 43677568 ~ 43677818 (+)
G2186628 NA non-coding downstream 118927 43679837 ~ 43680114 (+)
G2186178 NA other upstream 271921 43288075 ~ 43288696 (+)
G2186095 NA other upstream 409990 43089043 ~ 43150627 (+)
scaf4a scaf4 other upstream 633310 42902361 ~ 42955706 (+)
hunk LOC106601811 other upstream 743845 42807994 ~ 42833923 (+)
synj1 synj1 other upstream 893518 42618134 ~ 42720973 (+)
G2186982 NA other downstream 895698 44456608 ~ 44457229 (+)
G2187008 NA other downstream 950086 44510996 ~ 44511320 (+)
G2187834 NA other downstream 1790849 45351759 ~ 45353269 (+)
G2187837 NA other downstream 1795901 45356811 ~ 45357785 (+)

Expression


G2186289 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G2186289 Expression in each Bioproject

Bar chart with 6 bars.
G2186289 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network