G2186888



Basic Information


Item Value
gene id G2186888
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 44283967 ~ 44322925 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2500499
cctacagagagatgaacctggagaagagtcccctaagcaagctggtcctggggctctgttcacaaacacaaacacaccctacagagccccaggacaacagcacaattagacccaaccaaatcatgagaaaacaaaaagataattacttgacacattggaaagaattaacaaaaaaacagagcaaactagaatgctatttggccctaaacagagagtac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2500499 True 218 lncRNA 0.43 2 44283967 44322925

Neighbor


gene id symbol gene type direction distance location
ltn1 ltn1 coding upstream 662868 43548269 ~ 43621099 (+)
cct8 cct8 coding upstream 747294 43517321 ~ 43536673 (+)
LOC118945338 NA coding upstream 754598 43527499 ~ 43529369 (+)
grik1a LOC105026052 coding upstream 862261 43328743 ~ 43422689 (+)
trnal-cag-32 NA coding upstream 958289 43325596 ~ 43325678 (+)
gbe1a gbe1 coding downstream 595451 44918376 ~ 45083739 (+)
mtus2a LOC106563907 coding downstream 881632 45204557 ~ 45377103 (+)
LOC110518300 NA coding downstream 1065911 45383333 ~ 45391063 (+)
LOC110517637 LOC106563928 coding downstream 1086204 45409129 ~ 45422914 (+)
LOC118945264 NA coding downstream 1155264 45477230 ~ 45480543 (+)
G2186851 NA non-coding upstream 74945 44208727 ~ 44209022 (+)
G2186840 NA non-coding upstream 87062 44177010 ~ 44196905 (+)
G2186829 NA non-coding upstream 117596 44145292 ~ 44166371 (+)
G2186836 NA non-coding upstream 118424 44163231 ~ 44165543 (+)
G2186801 NA non-coding upstream 216404 44061344 ~ 44067563 (+)
G2186924 NA non-coding downstream 11253 44334178 ~ 44335704 (+)
G2186925 NA non-coding downstream 14106 44337031 ~ 44337832 (+)
G2186928 NA non-coding downstream 19617 44342542 ~ 44343399 (+)
G2186957 NA non-coding downstream 74895 44397820 ~ 44402460 (+)
G2186968 NA non-coding downstream 98595 44421520 ~ 44423859 (+)
G2186289 NA other upstream 723057 43560617 ~ 43560910 (+)
G2186178 NA other upstream 995271 43288075 ~ 43288696 (+)
G2186095 NA other upstream 1133340 43089043 ~ 43150627 (+)
scaf4a scaf4 other upstream 1356660 42902361 ~ 42955706 (+)
hunk LOC106601811 other upstream 1467195 42807994 ~ 42833923 (+)
G2186982 NA other downstream 133683 44456608 ~ 44457229 (+)
G2187008 NA other downstream 188071 44510996 ~ 44511320 (+)
G2187834 NA other downstream 1028834 45351759 ~ 45353269 (+)
G2187837 NA other downstream 1033886 45356811 ~ 45357785 (+)

Expression


G2186888 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G2186888 Expression in each Bioproject

Bar chart with 19 bars.
G2186888 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network