G2189537



Basic Information


Item Value
gene id G2189537
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 47172741 ~ 47173070 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2503988
CCAGGCCACAGAGAGTCTATACTAATGGTACCATGCCAGGCAGGCCACAGAGAGTCTATACTAATGGTACCATGTCAGACAGGCCACAGAGAGTCTATACTAATGATACCATGTCAGACCGCTTACTGCCAGGCCACAGAGAGTCTATACTAATGGTACCATGTCAGACAGGCCACAGAGAGTCTATACTAATGGTACCATGTCAGACAGGCCACAGAGAGTCTATACTAATGGTACCATGTCAGACAGGCCACAGAGAGTCTATACTAATGGTACCATGTCAGACAGGCCACAGAGAGTTGATACTAATGGTACCATGTCAGACAGGCC

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2503988 True 330 lncRNA 0.48 1 47172741 47173070
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110510302 LOC106563936 coding upstream 284207 46863262 ~ 46888534 (+)
inpp5kb LOC106563939 coding upstream 537021 46588208 ~ 46636264 (+)
LOC118945337 LOC108237022 coding upstream 608742 46504069 ~ 46563999 (+)
LOC110517633 LOC106604056 coding upstream 684002 46446951 ~ 46489028 (+)
LOC110517634 LOC106563910 coding upstream 732865 46377726 ~ 46439876 (+)
c1qa c1qc coding downstream 69935 47243005 ~ 47270503 (+)
c1qc LOC106591842 coding downstream 107027 47280097 ~ 47287013 (+)
c1qb c1qb coding downstream 130968 47304038 ~ 47314715 (+)
hoatz LOC100286538 coding downstream 170489 47343559 ~ 47359357 (+)
layna LOC106563960 coding downstream 194024 47367094 ~ 47385736 (+)
G2189535 NA non-coding upstream 2254 47169230 ~ 47170487 (+)
G2189531 NA non-coding upstream 15726 47156542 ~ 47157015 (+)
G2189527 NA non-coding upstream 26795 47144839 ~ 47145946 (+)
G2189522 NA non-coding upstream 38039 47134465 ~ 47134702 (+)
G2189384 NA non-coding upstream 72520 47099883 ~ 47100221 (+)
G2189538 NA non-coding downstream 478 47173548 ~ 47173837 (+)
polq LOC106595115 non-coding downstream 5298 47105413 ~ 47186621 (+)
G2189542 NA non-coding downstream 15203 47188273 ~ 47190605 (+)
G2189544 NA non-coding downstream 23849 47196919 ~ 47199751 (+)
G2189551 NA non-coding downstream 57365 47230435 ~ 47231210 (+)
G2189534 NA other upstream 7215 47165061 ~ 47165526 (+)
G2189323 LOC107735056 other upstream 95268 47070742 ~ 47077473 (+)
G2189283 NA other upstream 229982 46895556 ~ 46942759 (+)
G2188866 NA other upstream 414721 46757250 ~ 46758020 (+)
G2189507 LOC106563947 other downstream 14485 47187555 ~ 47224353 (+)
G2189691 NA other downstream 392179 47565249 ~ 47567756 (+)
G2189694 NA other downstream 454232 47627302 ~ 47639517 (+)

Expression


G2189537 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G2189537 Expression in each Bioproject

Bar chart with 15 bars.
G2189537 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network