G2190269


Basic Information

Item Value
gene id G2190269
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 280185 ~ 281518 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2505038
actcacactgacagggttacggttggagtcacactgacagggttacggttggactcacactgacagggttactgttggactcgcactgacagggttacggtgggactcacactgacagggttacggttggactcacactgacagggttacggttggactcacactgacagggttacggttggactcacactgacagggttacggttggactcacactgacagggttacggttggagttactgacagggttacggttggagtcactgacagggttacggttggactcgcactgacagggttacggttggagtcactgacagggttacggttggactcacactgacagggttacggttggagtcactgacagggttacggttggactcacactgacagggttacggttggactcacactgacagggttaaggttggagtcacactgacagggttacggttggactcacactgacagggttacggttggactcacactgacagggttacggttggagtcacactgacagggttactgttggactcacactgacagggttacggttggagtcacactgacagggttacggttggagtcacactgacagggttacggttgg

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2505038 True 616 lncRNA 0.54 2 280185 281518

Neighbor

gene id symbol gene type direction distance location
LOC118945785 NA coding downstream 31966 247827 ~ 248219 (-)
ice2 LOC106584843 coding upstream 119232 400750 ~ 443655 (-)
LOC110521129 LOC106584844 coding upstream 172940 454458 ~ 465246 (-)
LOC110514560 LOC106584847 coding upstream 276962 558480 ~ 560473 (-)
LOC110514559 LOC106584847 coding upstream 279763 561281 ~ 563251 (-)
LOC118945827 LOC106584847 coding upstream 282660 564178 ~ 565839 (-)
G2190241 NA non-coding downstream 19492 179194 ~ 260693 (-)
G2190261 NA non-coding downstream 29602 248748 ~ 250583 (-)
G2190035 NA non-coding downstream 204108 75309 ~ 76077 (-)
G2190306 NA non-coding upstream 80435 361953 ~ 362562 (-)
G2190321 NA non-coding upstream 102518 384036 ~ 384666 (-)
G2190332 NA non-coding upstream 121363 402881 ~ 416960 (-)
G2190338 NA non-coding upstream 128957 410475 ~ 452420 (-)
G2190387 NA non-coding upstream 218856 500374 ~ 500821 (-)
G2190401 LOC106584847 other upstream 283305 564823 ~ 571146 (-)
G2191276 NA other upstream 962552 1244070 ~ 1245812 (-)
G2191462 NA other upstream 1487901 1769419 ~ 1769938 (-)
megf11 LOC104967286 other upstream 2006809 2017741 ~ 2521453 (-)
G2191831 NA other upstream 2144704 2426222 ~ 2427826 (-)

Expression

G2190269 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G2190269 Expression in each Bioproject

Bar chart with 5 bars.
G2190269 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network