G2191462



Basic Information


Item Value
gene id G2191462
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 1769419 ~ 1769938 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2506626
CCATGAACACTACTATGACCATGAACACTGCCATGAACACTACCATGAACACTACCATGAACACTACCATGAACACTACTGTGACCATTAACACTACTATAACCATGAACACTACCATGAACACTACTATGACCATGAACACTACCATTAACACTACCATGAACACTACCATTAACACTACTATGACCATGAACACTACTATGACCATGAACACTGCCATGAACACTACCATGAACACTACCATGAACACTACCATGAACACTACTGTGACCATTAACACTACTATAACCATGAACACTACCATGAACACTACCATGAACACTACTGTGACCATTAACACTACTATAACCATGAACACTATCATGAACACTACTGTGACCATGAACACTACCATTAACACTACTATAACCATGAACACTATCATGAACACTACTGTGACCATGAACAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2506626 True 448 TUCP 0.39 2 1769419 1769938

Neighbor


gene id symbol gene type direction distance location
stoml1 LOC106584865 coding downstream 50579 1707834 ~ 1718840 (-)
stra6 stra6 coding downstream 377558 1285342 ~ 1391861 (-)
neil1 NA coding downstream 601525 1155519 ~ 1167894 (-)
si:dkeyp-73b11.8 LOC106561864 coding downstream 802648 943768 ~ 966771 (-)
usp3 LOC106584856 coding downstream 835151 885955 ~ 934268 (-)
ints14 vwa9 coding upstream 71215 1841153 ~ 1859700 (-)
dennd4a LOC106584873 coding upstream 91880 1861483 ~ 1973408 (-)
trnaq-cug-120 NA coding upstream 209029 1978967 ~ 1979038 (-)
megf11 LOC104967286 coding upstream 247803 2017741 ~ 2521453 (-)
LOC118945930 NA coding upstream 765389 2535327 ~ 2535457 (-)
G2191444 NA non-coding downstream 12827 1754385 ~ 1756592 (-)
G2191445 LOC106584867 non-coding downstream 16822 1750906 ~ 1752597 (-)
G2191432 NA non-coding downstream 99666 1669515 ~ 1669753 (-)
G2191413 NA non-coding downstream 182454 1579124 ~ 1586965 (-)
G2191394 NA non-coding downstream 221675 1547532 ~ 1547744 (-)
G2191463 NA non-coding upstream 623 1770561 ~ 1771129 (-)
G2191477 NA non-coding upstream 90851 1860789 ~ 1861257 (-)
G2191487 NA non-coding upstream 127969 1897907 ~ 1898149 (-)
G2191490 NA non-coding upstream 146316 1916254 ~ 1916713 (-)
G2191276 NA other downstream 523607 1244070 ~ 1245812 (-)
G2190401 LOC106584847 other downstream 1198273 564823 ~ 571146 (-)
G2191831 NA other upstream 656284 2426222 ~ 2427826 (-)
G2192807 NA other upstream 1213873 2983811 ~ 2986062 (-)
G2192984 NA other upstream 1696142 3466080 ~ 3466547 (-)
LOC110521162 NA other upstream 2168289 3936827 ~ 3940571 (-)

Expression


G2191462 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G2191462 Expression in each Bioproject

Bar chart with 18 bars.
G2191462 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network