G2198837



Basic Information


Item Value
gene id G2198837
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 11144213 ~ 11144672 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2515932
ctccttcgttgcccgggcggtgtgtttgggatcattgtcatgctgaaagacccagccacgtttcatcttcaatgcccttgctgatggaaggaggttttcactcaaaatctcacgatacatggccccattcattctttcctttacacagatcagtcgtcctggtccctttgcagaaaaacagccccaaagcatgatgtttccacccccatgcttcacagtaggtatggtgttttttggatgcaactcagcattctttgtcctccaaacacaacgagttgagtctttaccaaaaagttatattttggtttcatctgaccatatgacattctcccaatcttcttctggatcatccaaatgctctctagcaaacttcagacgggcctggaaatgtactggcttaagcagggggacacgtctggcactgcaggatttgagtccctggcggcgtagtgtgttactg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2515932 True 460 TUCP 0.47 1 11144213 11144672
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110521310 gramd4 coding upstream 21816 11069904 ~ 11122397 (+)
LOC110521307 LOC106584597 coding upstream 221897 10921288 ~ 10922316 (+)
LOC110521306 LOC106584595 coding upstream 223709 10799756 ~ 10920504 (+)
LOC110521301 LOC106584589 coding upstream 668650 10471852 ~ 10475563 (+)
LOC110522733 LOC106584588 coding upstream 685557 10322109 ~ 10458656 (+)
LOC110521313 cerk coding downstream 57011 11201683 ~ 11226086 (+)
LOC118945803 LOC106584602 coding downstream 103784 11248456 ~ 11253726 (+)
LOC118945779 NA coding downstream 109142 11253814 ~ 11254241 (+)
LOC110521314 NA coding downstream 115339 11260011 ~ 11261183 (+)
LOC118945769 NA coding downstream 121681 11266353 ~ 11273794 (+)
G2198832 NA non-coding upstream 5214 11138774 ~ 11138999 (+)
G2198830 NA non-coding upstream 6442 11137059 ~ 11137771 (+)
G2198829 NA non-coding upstream 7226 11136287 ~ 11136987 (+)
G2198828 NA non-coding upstream 7941 11135772 ~ 11136272 (+)
G2198827 NA non-coding upstream 8476 11135491 ~ 11135737 (+)
G2198891 NA non-coding downstream 81826 11226498 ~ 11226716 (+)
G2198903 NA non-coding downstream 100740 11245412 ~ 11263099 (+)
G2199833 NA non-coding downstream 253610 11398282 ~ 11406693 (+)
G2199998 NA non-coding downstream 324591 11469263 ~ 11469714 (+)
G2200043 NA non-coding downstream 361490 11506162 ~ 11506401 (+)
G2198247 NA other upstream 920096 10221650 ~ 10224117 (+)
G2197955 NA other upstream 1523926 9619867 ~ 9620287 (+)
calcb LOC100135819 other upstream 1694560 9418139 ~ 9449834 (+)
G2197055 LOC106584658 other upstream 2548705 8593374 ~ 8595508 (+)
LOC110521323 LOC106561036 other downstream 591802 11683849 ~ 11796935 (+)
G2202196 NA other downstream 2056466 13201138 ~ 13201491 (+)
LOC110521355 LOC106584515 other downstream 2147564 13292190 ~ 13301806 (+)
tnnt3a LOC100136357 other downstream 2291136 13435735 ~ 13462187 (+)
G2203653 NA other downstream 3414775 14559447 ~ 14567103 (+)

Expression


G2198837 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G2198837 Expression in each Bioproject

Bar chart with 21 bars.
G2198837 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network