G2208093



Basic Information


Item Value
gene id G2208093
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 18187125 ~ 18187525 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2526189
tccatggttagtctgtcatcatgtttagtattctccatggttagtctgtcatcatgtttagtgttctccatggttagtctgtcatcatgtttagtgttctccatggttagtctgtcatcatgtttagtgttctccatggttagtctgtcatcatgtttagtgttctccatggttagtctgtcatcatgtttagtgttctccatggttagtctgtcatcatggttagtgttctccatggttagtctgtcatcatggttagtgttctccatggttagtctgtcatcatggttagtgttctccatggttagtctgtcatcatgtttagtgttctccatggttagtctgtcatcatgtttagtgttctccatggttagtctgtcatcatggttagtgttctccat

Function


NR:

description
PREDICTED: uncharacterized protein LOC106575024

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2526189 True 401 TUCP 0.40 1 18187125 18187525
Loading

Neighbor


gene id symbol gene type direction distance location
s1pr3a LOC106584412 coding downstream 115705 18066927 ~ 18071420 (-)
LOC110521456 LOC106584414 coding downstream 176494 17960092 ~ 18010631 (-)
cks2 LOC106584418 coding downstream 260316 17924927 ~ 17926809 (-)
rex1bd cssa23h19orf60 coding downstream 342509 17829592 ~ 17844616 (-)
LOC110521449 tmem59l coding downstream 372034 17791605 ~ 17815091 (-)
trnaq-uug-130 NA coding upstream 67459 18254984 ~ 18255055 (-)
LOC110521464 LOC106584409 coding upstream 121512 18306119 ~ 18392555 (-)
LOC110521466 LOC106584407 coding upstream 243658 18431183 ~ 18472493 (-)
LOC110521465 LOC107586405 coding upstream 285235 18472760 ~ 18543124 (-)
LOC110521468 LOC106584260 coding upstream 479793 18667318 ~ 18674679 (-)
G2208088 NA non-coding downstream 6973 18179934 ~ 18180152 (-)
G2207950 NA non-coding downstream 268048 17918220 ~ 17919077 (-)
G2207930 NA non-coding downstream 299537 17886419 ~ 17887588 (-)
G2208096 NA non-coding upstream 7705 18195230 ~ 18195454 (-)
G2208228 NA non-coding upstream 220555 18408080 ~ 18410134 (-)
G2208363 NA non-coding upstream 474339 18661864 ~ 18662219 (-)
G2208554 NA non-coding upstream 478162 18665687 ~ 18666243 (-)
G2208589 NA non-coding upstream 580186 18767711 ~ 18767940 (-)
G2208092 NA other downstream 1140 18185515 ~ 18185985 (-)
G2207736 NA other downstream 686818 17482369 ~ 17500307 (-)
G2206890 NA other downstream 839556 17346817 ~ 17347569 (-)
G2206739 NA other downstream 1162774 17023432 ~ 17024351 (-)
LOC110521421 LOC106584447 other downstream 1807457 16377972 ~ 16379704 (-)
LOC110521505 LOC106584372 other upstream 1885964 20067742 ~ 20083690 (-)
LOC110521508 LOC106584371 other upstream 1946611 20129636 ~ 20197258 (-)
G2210769 NA other upstream 2330815 20518340 ~ 20523111 (-)
G2211274 ttc14 other upstream 3117316 21304841 ~ 21306542 (-)

Expression


G2208093 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G2208093 Expression in each Bioproject

Bar chart with 16 bars.
G2208093 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network