G2211729



Basic Information


Item Value
gene id G2211729
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 21879330 ~ 21879587 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2530196
aacttttcaccagcgatcaagacgacacactgagcgtaaatatatatattgattgcaattgttcccgaatgagtgagcgttcatgtgtaaaggattagcatttcaattgttataattatcactctgtagtgacttcttagtcgacccccacttccccttttgtctaacaagccgccatgccggtttagcccactaggacacattctcctatcatttcgtgtaaccacatttaccttgtttgtttatgcatttctgtga

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2530196 True 258 lncRNA 0.40 1 21879330 21879587

Neighbor


gene id symbol gene type direction distance location
LOC110521547 NA coding upstream 406407 21390046 ~ 21472923 (+)
LOC110521546 LOC106584342 coding upstream 433093 21443912 ~ 21446237 (+)
LOC110521544 fxr1 coding upstream 549065 21321180 ~ 21330265 (+)
ttc14 ttc14 coding upstream 572166 21302078 ~ 21307164 (+)
LOC110521541 LOC106584346 coding upstream 582704 21291300 ~ 21296626 (+)
LOC110521550 LOC106613883 coding downstream 24626 21904213 ~ 21918248 (+)
LOC110521549 LOC106584339 coding downstream 39493 21919080 ~ 21926480 (+)
LOC110521552 LOC106584338 coding downstream 59496 21939083 ~ 22012496 (+)
LOC118945801 NA coding downstream 222225 22101812 ~ 22103802 (+)
mrpl55 LOC106584336 coding downstream 242188 22121775 ~ 22125310 (+)
G2211728 NA non-coding upstream 37 21878896 ~ 21879293 (+)
G2211716 NA non-coding upstream 19457 21857778 ~ 21859873 (+)
G2211557 NA non-coding upstream 210638 21667919 ~ 21668692 (+)
G2211558 NA non-coding upstream 214829 21663928 ~ 21664501 (+)
G2211602 NA non-coding upstream 220826 21658227 ~ 21658504 (+)
G2211731 NA non-coding downstream 4186 21883773 ~ 21884002 (+)
G2211752 NA non-coding downstream 144879 22024466 ~ 22025206 (+)
G2211795 NA non-coding downstream 156641 22036228 ~ 22036748 (+)
G2211796 NA non-coding downstream 157323 22036910 ~ 22037335 (+)
G2211798 NA non-coding downstream 160974 22040561 ~ 22041345 (+)
G2211556 NA other upstream 215491 21659650 ~ 21663839 (+)
LOC110521540 LOC106584347 other upstream 594039 21273731 ~ 21290307 (+)
G2209830 NA other upstream 1427738 20451162 ~ 20451592 (+)
LOC118945811 NA other upstream 2160675 19709234 ~ 19719196 (+)
LOC110520949 NA other upstream 2893954 18983689 ~ 18985409 (+)
G2212455 LOC106584324 other downstream 1170901 23050488 ~ 23051858 (+)
G2212563 LOC106584318 other downstream 1329188 23208775 ~ 23210516 (+)
G2213751 NA other downstream 1469412 23348999 ~ 23349217 (+)
LOC110521578 LOC106584313 other downstream 1631005 23510569 ~ 23610545 (+)
G2216024 LOC106584303 other downstream 3151411 25030998 ~ 25174051 (+)

Expression


G2211729 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G2211729 Expression in each Bioproject

Bar chart with 20 bars.
G2211729 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network