G2213430



Basic Information


Item Value
gene id G2213430
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 22747989 ~ 22776939 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2532018
atcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctttccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaatgtcagtctctcgatgtgcaaaactgatagagacataccccaagcgacttacagctgtaatcgcagcaaaaggtggcgctacaaagtattaacttaagggggctaaataattttgcacgcccaatttttcagtttttgatttgttaaaaaagtttgaaatatccaataaatgtcgtcccacttcatgattgtgtcccacttgttgttgattcttcacaaaaaaaatacagttttatat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2532018 True 338 lncRNA 0.38 2 22747989 22776939
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110522763 LOC100286605 coding downstream 93014 22180097 ~ 22654975 (-)
LOC110521557 LOC106584333 coding downstream 438153 22295614 ~ 22321717 (-)
LOC110521551 LOC106584337 coding downstream 640602 22010343 ~ 22107387 (-)
LOC110521548 LOC106584340 coding downstream 947172 21666793 ~ 21800817 (-)
LOC110521545 NA coding downstream 1387110 21352715 ~ 21360879 (-)
LOC110521561 LOC106584330 coding upstream 86436 22863375 ~ 22868980 (-)
LOC110521562 LOC106584329 coding upstream 98365 22875304 ~ 22963761 (-)
LOC110521564 LOC106584326 coding upstream 205578 22982517 ~ 23008109 (-)
LOC110521565 LOC106584325 coding upstream 224888 23001827 ~ 23025456 (-)
LOC110521566 LOC106584324 coding upstream 251679 23028618 ~ 23062275 (-)
G2213395 elavl4 non-coding downstream 2165 22689204 ~ 22745824 (-)
G2213396 LOC106613894 non-coding downstream 20268 22717223 ~ 22727721 (-)
G2213051 NA non-coding downstream 527916 22155089 ~ 22220073 (-)
G2213083 NA non-coding downstream 556851 22190439 ~ 22191138 (-)
G2213537 NA non-coding upstream 146313 22923252 ~ 23014524 (-)
G2213589 NA non-coding upstream 249197 23026136 ~ 23026365 (-)
G2213606 NA non-coding upstream 298159 23075098 ~ 23075304 (-)
G2212908 LOC106613883 other downstream 837253 21907963 ~ 21910736 (-)
G2212755 NA other downstream 1081374 21665964 ~ 21666615 (-)
G2211274 ttc14 other downstream 1441447 21304841 ~ 21306542 (-)
G2210769 NA other downstream 2224878 20518340 ~ 20523111 (-)
LOC110521508 LOC106584371 other downstream 2612774 20129636 ~ 20197258 (-)
G2213654 NA other upstream 401567 23178506 ~ 23179611 (-)
G2213647 NA other upstream 420708 23197647 ~ 23199406 (-)
G2217605 NA other upstream 3140415 25917354 ~ 25920245 (-)
G2217805 prrc2c other upstream 3459746 26236685 ~ 26237398 (-)

Expression


G2213430 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G2213430 Expression in each Bioproject

Bar chart with 20 bars.
G2213430 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network