G2214935



Basic Information


Item Value
gene id G2214935
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 24253526 ~ 24253793 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2533631
ccacaggaaagaaagacccagagttacctctgctgcagaggataagttcattagagttaccagcctcagaaattgcagcccaaataaatgcttcacagagttcaagtaactgacacatctcaacatcaactgttcagaggaggctgcatgaatcagtccttcatggtcgaattgctgcaaagaaaccactactaaaggacactaataataataagagacttgcttgggctaagaaacacgagcaatagacattagaccggtggaaatt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2533631 True 268 lncRNA 0.42 1 24253526 24253793

Neighbor


gene id symbol gene type direction distance location
LOC110521588 LOC106584306 coding upstream 20284 23895194 ~ 24233242 (+)
LOC110521587 LOC106584307 coding upstream 482781 23745350 ~ 23770745 (+)
LOC110521584 LOC106584308 coding upstream 510747 23670697 ~ 23743514 (+)
LOC110521578 LOC106584313 coding upstream 647019 23510569 ~ 23610545 (+)
LOC110521576 LOC106584315 coding upstream 781132 23450130 ~ 23472394 (+)
LOC118945828 NA coding downstream 539596 24793389 ~ 24802486 (+)
LOC110521590 LOC106613930 coding downstream 797899 25051692 ~ 25068480 (+)
LOC110522765 pik3ca coding downstream 843823 25097302 ~ 25108568 (+)
LOC110521596 LOC106584302 coding downstream 866855 25120648 ~ 25123578 (+)
LOC110521595 LOC106584300 coding downstream 869915 25123708 ~ 25144946 (+)
G2214927 NA non-coding upstream 6152 24247097 ~ 24247374 (+)
G2214662 NA non-coding upstream 29328 24223630 ~ 24224198 (+)
G2214661 NA non-coding upstream 30423 24222876 ~ 24223103 (+)
G2214657 NA non-coding upstream 36054 24217247 ~ 24217472 (+)
G2214645 NA non-coding upstream 52253 24201045 ~ 24201273 (+)
G2214963 NA non-coding downstream 25217 24279010 ~ 24324806 (+)
G2215093 NA non-coding downstream 121842 24375635 ~ 24375912 (+)
G2215107 NA non-coding downstream 129665 24383458 ~ 24383702 (+)
G2215239 NA non-coding downstream 226066 24479859 ~ 24480207 (+)
G2215252 NA non-coding downstream 237819 24491612 ~ 24491829 (+)
G2213751 NA other upstream 904309 23348999 ~ 23349217 (+)
G2212563 LOC106584318 other upstream 1043010 23208775 ~ 23210516 (+)
G2212455 LOC106584324 other upstream 1201668 23050488 ~ 23051858 (+)
G2211556 NA other upstream 2589687 21659650 ~ 21663839 (+)
G2216024 LOC106584303 other downstream 777205 25030998 ~ 25174051 (+)
G2216357 NA other downstream 1110459 25364252 ~ 25373610 (+)
LOC110522768 LOC106584287 other downstream 1314047 25566527 ~ 25590680 (+)
LOC110521611 LOC106584283 other downstream 1434298 25688091 ~ 25825503 (+)
G2217159 LOC106584278 other downstream 1873261 26127054 ~ 26133044 (+)

Expression


G2214935 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G2214935 Expression in each Bioproject

Bar chart with 21 bars.
G2214935 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network