G2216348 (rabggta)


Basic Information

Item Value
gene id G2216348
gene name rabggta
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 25339829 ~ 25341601 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU2535128
CCTGCACCAACTCTCAGACCGACCTGTGTACAGAGCACAGTCTCTGTGAGTGTGTTTCTCAGTCCAGTGCACGGTCAGGTTGTGTTCATTAATGATGTCACTGATAGTGCCAGGAGGAAGCGCACAGATCCAGACAGGGCTGTGTCTGAAGTGAGGATGGACACTCCTCCATTCCACACGCTGGGGCTGACCATCCAACACCAGCATCAGACCACTAGATGAAGC

Function

symbol description
rabggta Predicted to enable protein prenyltransferase activity and zinc ion binding activity. Predicted to contribute to Rab geranylgeranyltransferase activity. Predicted to be involved in protein geranylgeranylation. Predicted to act upstream of or within protein prenylation. Predicted to be part of Rab-protein geranylgeranyltransferase complex. Predicted to be active in cytoplasm. Orthologous to human RABGGTA (Rab geranylgeranyltransferase subunit alpha).

NR:

description
geranylgeranyl transferase type-2 subunit alpha

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU2535128 True 225 lncRNA 0.53 3 25339829 25341601

Neighbor

gene id symbol gene type direction distance location
LOC110521600 NA coding upstream 39891 25297795 ~ 25299938 (+)
LOC110522767 LOC106584297 coding upstream 68754 25269055 ~ 25271075 (+)
LOC110521597 LOC106584301 coding upstream 85816 25246389 ~ 25254013 (+)
LOC110522766 NA coding upstream 120539 25208384 ~ 25219290 (+)
LOC110521595 LOC106584300 coding upstream 194883 25123708 ~ 25144946 (+)
LOC110521603 LOC106584291 coding downstream 14548 25356149 ~ 25382798 (+)
LOC110521605 NA coding downstream 70712 25412311 ~ 25426874 (+)
rpf1 rpf1 coding downstream 190048 25531649 ~ 25540983 (+)
LOC110522768 LOC106584287 coding downstream 224926 25566527 ~ 25590680 (+)
LOC110521607 LOC106584286 coding downstream 294981 25636582 ~ 25653905 (+)
G2216314 LOC106584296 non-coding upstream 59499 25278734 ~ 25280330 (+)
G2216088 NA non-coding upstream 151981 25133633 ~ 25187848 (+)
G2216096 NA non-coding upstream 186356 25153092 ~ 25153473 (+)
G2216073 NA non-coding upstream 198788 25114519 ~ 25141041 (+)
LOC110522765 pik3ca non-coding upstream 233206 25097302 ~ 25108568 (+)
G2216355 NA non-coding downstream 9244 25350845 ~ 25355952 (+)
LOC110521610 NA non-coding downstream 340833 25682300 ~ 25687956 (+)
G2217031 NA non-coding downstream 557623 25899224 ~ 25899854 (+)
G2217047 NA non-coding downstream 575375 25916976 ~ 25917700 (+)
G2216024 LOC106584303 other upstream 226231 25030998 ~ 25174051 (+)
LOC110521578 LOC106584313 other upstream 1754249 23510569 ~ 23610545 (+)
G2213751 NA other upstream 1990612 23348999 ~ 23349217 (+)
G2212563 LOC106584318 other upstream 2129313 23208775 ~ 23210516 (+)
G2212455 LOC106584324 other upstream 2287971 23050488 ~ 23051858 (+)
G2216357 NA other downstream 22651 25364252 ~ 25373610 (+)
LOC110521611 LOC106584283 other downstream 346490 25688091 ~ 25825503 (+)
G2217159 LOC106584278 other downstream 785453 26127054 ~ 26133044 (+)
G2217442 NA other downstream 1265922 26607523 ~ 26607943 (+)

Expression


Co-expression Network