G2216357



Basic Information


Item Value
gene id G2216357
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 25364252 ~ 25373610 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU2535138
gatgggaagatggatggagccaaatacaggaccattctggaagaatgatggagtctgcaaaagacctgagactgggacagagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaataataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaatgtcagtctctcgatgtgcaaaactgatagagac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU2535138 True 334 TUCP 0.42 2 25364252 25373610

Neighbor


gene id symbol gene type direction distance location
LOC110521600 NA coding upstream 64314 25297795 ~ 25299938 (+)
LOC110522767 LOC106584297 coding upstream 93177 25269055 ~ 25271075 (+)
LOC110521597 LOC106584301 coding upstream 110239 25246389 ~ 25254013 (+)
LOC110522766 NA coding upstream 144962 25208384 ~ 25219290 (+)
LOC110521595 LOC106584300 coding upstream 219306 25123708 ~ 25144946 (+)
LOC110521605 NA coding downstream 38703 25412311 ~ 25426874 (+)
rpf1 rpf1 coding downstream 158039 25531649 ~ 25540983 (+)
LOC110522768 LOC106584287 coding downstream 192917 25566527 ~ 25590680 (+)
LOC110521607 LOC106584286 coding downstream 262972 25636582 ~ 25653905 (+)
LOC110521610 NA coding downstream 308690 25682300 ~ 25687956 (+)
G2216355 NA non-coding upstream 8300 25350845 ~ 25355952 (+)
G2216348 rabggta non-coding upstream 22651 25339829 ~ 25341601 (+)
G2216314 LOC106584296 non-coding upstream 83922 25278734 ~ 25280330 (+)
G2216088 NA non-coding upstream 176404 25133633 ~ 25187848 (+)
G2216024 LOC106584303 non-coding upstream 190201 25030998 ~ 25174051 (+)
G2217031 NA non-coding downstream 525614 25899224 ~ 25899854 (+)
G2217047 NA non-coding downstream 543366 25916976 ~ 25917700 (+)
LOC110521625 mettl13 non-coding downstream 939870 26312180 ~ 26314731 (+)
LOC110521578 LOC106584313 other upstream 1778672 23510569 ~ 23610545 (+)
G2213751 NA other upstream 2015035 23348999 ~ 23349217 (+)
G2212563 LOC106584318 other upstream 2153736 23208775 ~ 23210516 (+)
G2212455 LOC106584324 other upstream 2312394 23050488 ~ 23051858 (+)
LOC110521611 LOC106584283 other downstream 314481 25688091 ~ 25825503 (+)
G2217159 LOC106584278 other downstream 753444 26127054 ~ 26133044 (+)
G2217442 NA other downstream 1233913 26607523 ~ 26607943 (+)
LOC110521633 LOC106584207 other downstream 1348375 26695809 ~ 26795605 (+)

Expression


G2216357 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G2216357 Expression in each Bioproject

Bar chart with 20 bars.
G2216357 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network